Incidental Mutation 'R5548:Slc16a5'
List |< first << previous [record 32 of 45] next >> last >|
ID435001
Institutional Source Beutler Lab
Gene Symbol Slc16a5
Ensembl Gene ENSMUSG00000045775
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 5
SynonymsMCT5, A130015N09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5548 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115462474-115474398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115469804 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 271 (Y271F)
Ref Sequence ENSEMBL: ENSMUSP00000090102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092445] [ENSMUST00000106532] [ENSMUST00000153466]
Predicted Effect probably benign
Transcript: ENSMUST00000092445
AA Change: Y271F

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090102
Gene: ENSMUSG00000045775
AA Change: Y271F

DomainStartEndE-ValueType
Pfam:MFS_1 15 303 5.9e-31 PFAM
Pfam:MFS_1 302 459 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106532
SMART Domains Protein: ENSMUSP00000102142
Gene: ENSMUSG00000045775

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146500
Predicted Effect probably benign
Transcript: ENSMUST00000153466
SMART Domains Protein: ENSMUSP00000117727
Gene: ENSMUSG00000045775

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the monocarboxylate transporter family and the major facilitator superfamily. The encoded protein is localized to the cell membrane and acts as a proton-linked transporter of bumetanide. Transport by the encoded protein is inhibited by four loop diuretics, nateglinide, thiazides, probenecid, and glibenclamide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,973,867 D191G probably benign Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
C77080 GGTG GGTGTG 4: 129,223,980 probably null Het
Cdh12 C T 15: 21,492,654 T253I probably damaging Het
Cox4i2 C T 2: 152,757,091 T56I possibly damaging Het
Cpsf1 A C 15: 76,597,327 D1141E possibly damaging Het
D3Ertd254e C G 3: 36,165,491 H554Q possibly damaging Het
Dennd5b T C 6: 149,019,349 probably null Het
Dnah6 A T 6: 73,151,689 D1194E probably damaging Het
Dst C A 1: 34,189,328 H1676N probably benign Het
Fitm1 A G 14: 55,575,697 T6A probably benign Het
Galnt5 T A 2: 58,014,910 V495E probably damaging Het
Gm8994 T C 6: 136,329,570 V343A probably damaging Het
Gtf2h2 C A 13: 100,481,036 R206L possibly damaging Het
Heatr5a A T 12: 51,958,951 Y80* probably null Het
Il17ra A G 6: 120,478,473 R348G probably benign Het
Mmp28 A T 11: 83,443,907 Y340* probably null Het
Mrgprb8 A T 7: 48,389,030 T150S probably benign Het
Ms4a10 A T 19: 10,968,120 probably null Het
Muc5b A T 7: 141,863,942 I3542F probably benign Het
Mybbp1a T C 11: 72,446,172 L578P probably damaging Het
N4bp2l1 G A 5: 150,572,955 R65* probably null Het
Nup188 T A 2: 30,326,493 Y770N probably damaging Het
Olfr284 T A 15: 98,340,372 T206S probably benign Het
Olfr918 T C 9: 38,673,304 I60V probably benign Het
Pbrm1 T A 14: 31,105,424 C1257S probably damaging Het
Pcdh8 T C 14: 79,767,502 T1028A probably damaging Het
Pramef25 C T 4: 143,949,980 E185K probably benign Het
Qars C T 9: 108,512,918 P348S possibly damaging Het
Qrfpr T A 3: 36,221,926 Q105L possibly damaging Het
Slc10a5 A T 3: 10,334,317 Y428N probably benign Het
Slc1a4 T A 11: 20,304,429 Q479L possibly damaging Het
Slc38a1 C T 15: 96,590,474 G143S probably damaging Het
Susd1 G A 4: 59,369,577 T364M probably benign Het
Tmem132c T A 5: 127,551,523 Y496* probably null Het
Tmem63b A G 17: 45,664,958 I523T probably damaging Het
Tnrc6c T C 11: 117,760,843 S1731P possibly damaging Het
Ttll3 T A 6: 113,393,117 W139R probably damaging Het
Ubr4 C T 4: 139,460,090 T3823M probably damaging Het
Vangl1 T A 3: 102,184,446 D108V possibly damaging Het
Vmn1r120 T C 7: 21,053,557 I76M probably benign Het
Wdr17 A G 8: 54,703,851 Y17H probably damaging Het
Xkr4 C T 1: 3,216,930 A346T probably damaging Het
Zfp600 T A 4: 146,196,449 S562R possibly damaging Het
Other mutations in Slc16a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Slc16a5 APN 11 115465001 missense probably benign
IGL02190:Slc16a5 APN 11 115462609 start codon destroyed probably null 1.00
IGL02852:Slc16a5 APN 11 115469579 missense probably benign 0.03
IGL02942:Slc16a5 APN 11 115469350 missense possibly damaging 0.50
R0090:Slc16a5 UTSW 11 115464925 missense probably damaging 1.00
R1928:Slc16a5 UTSW 11 115470016 missense probably damaging 0.98
R1930:Slc16a5 UTSW 11 115469368 missense probably damaging 0.99
R1931:Slc16a5 UTSW 11 115469368 missense probably damaging 0.99
R5255:Slc16a5 UTSW 11 115462675 missense probably benign 0.13
R5592:Slc16a5 UTSW 11 115472782 missense probably benign 0.05
R5770:Slc16a5 UTSW 11 115472778 missense possibly damaging 0.70
R8381:Slc16a5 UTSW 11 115469890 missense probably benign
Z1176:Slc16a5 UTSW 11 115469372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATACCTACACGCAGCTGC -3'
(R):5'- CACACATGGACAGGCTGTAC -3'

Sequencing Primer
(F):5'- CGCAGCTGCCTGGCAAC -3'
(R):5'- TGGACAGGCTGTACACCAG -3'
Posted On2016-10-24