Incidental Mutation 'R5554:Nbr1'
ID435304
Institutional Source Beutler Lab
Gene Symbol Nbr1
Ensembl Gene ENSMUSG00000017119
Gene Nameneighbor of Brca1 gene 1
Synonyms
MMRRC Submission 043111-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5554 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101552149-101581951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101564807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 129 (T129I)
Ref Sequence ENSEMBL: ENSMUSP00000102831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071537] [ENSMUST00000103098] [ENSMUST00000103099] [ENSMUST00000107208] [ENSMUST00000107212] [ENSMUST00000107213] [ENSMUST00000107218] [ENSMUST00000123558]
Predicted Effect probably benign
Transcript: ENSMUST00000071537
AA Change: T129I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071467
Gene: ENSMUSG00000017119
AA Change: T129I

DomainStartEndE-ValueType
PB1 4 86 2.05e-8 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
Pfam:N_BRCA1_IG 378 479 7.1e-34 PFAM
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103098
AA Change: T129I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099387
Gene: ENSMUSG00000017119
AA Change: T129I

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000103099
AA Change: T129I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099388
Gene: ENSMUSG00000017119
AA Change: T129I

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107208
AA Change: T129I

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102826
Gene: ENSMUSG00000017119
AA Change: T129I

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 1e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107212
AA Change: T129I

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102830
Gene: ENSMUSG00000017119
AA Change: T129I

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 3e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 689 719 N/A INTRINSIC
PDB:2MJ5|B 910 956 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107213
AA Change: T129I

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102831
Gene: ENSMUSG00000017119
AA Change: T129I

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 677 707 N/A INTRINSIC
PDB:2MJ5|B 898 944 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107218
AA Change: T129I

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102836
Gene: ENSMUSG00000017119
AA Change: T129I

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000123558
AA Change: T129I

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133619
Gene: ENSMUSG00000017119
AA Change: T129I

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146452
Predicted Effect probably benign
Transcript: ENSMUST00000149019
SMART Domains Protein: ENSMUSP00000119900
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
coiled coil region 50 89 N/A INTRINSIC
Pfam:N_BRCA1_IG 138 239 2.3e-34 PFAM
low complexity region 267 278 N/A INTRINSIC
coiled coil region 473 500 N/A INTRINSIC
PDB:2MJ5|B 659 705 1e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174013
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was originally identified as an ovarian tumor antigen monitored in ovarian cancer. The encoded protein contains a B-box/coiled-coil motif, which is present in many genes with transformation potential. It functions as a specific autophagy receptor for the selective autophagic degradation of peroxisomes by forming intracellular inclusions with ubiquitylated autophagic substrates. This gene is located on a region of chromosome 17q21.1 that is in close proximity to the BRCA1 tumor suppressor gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous mice of the genetic truncation allele had an age-dependent increase in bone mass and bone mineral density. Mice homozygous for a floxed allele activated in T cells exhibit decreased ovalbumin-induced inflammation and defective Th2 polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,413,981 R227L probably benign Het
Adamtsl1 A G 4: 86,276,945 Q533R possibly damaging Het
Adgb C T 10: 10,340,473 R1524H probably damaging Het
Ank2 A T 3: 126,998,973 N739K possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Anxa10 G A 8: 62,061,046 P249L possibly damaging Het
Banp G A 8: 121,991,595 E183K probably damaging Het
BC051665 C G 13: 60,784,621 L83F probably damaging Het
Btn1a1 A T 13: 23,459,125 F385I possibly damaging Het
Chchd4 A T 6: 91,465,017 *140R probably null Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dlx2 G A 2: 71,545,461 R173C possibly damaging Het
Dmbt1 C A 7: 131,099,300 Y1069* probably null Het
Dopey1 T A 9: 86,521,657 F1637I probably damaging Het
Dusp18 T C 11: 3,897,202 I64T probably damaging Het
Evi5l A G 8: 4,206,491 probably benign Het
Fam212b T A 3: 105,716,614 S82R possibly damaging Het
Fiz1 T C 7: 5,012,850 H47R probably damaging Het
Fndc3b G T 3: 27,643,013 P17T possibly damaging Het
Foxa1 T A 12: 57,542,291 Q381L probably benign Het
Gda A G 19: 21,428,473 probably null Het
Gm10044 T C 14: 7,771,181 noncoding transcript Het
Gm12258 T A 11: 58,858,468 S156R possibly damaging Het
Gm973 A G 1: 59,526,972 R117G probably benign Het
Grwd1 C T 7: 45,830,640 V48I probably damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Itga1 A T 13: 114,992,474 C549* probably null Het
Kmt2c C A 5: 25,294,610 G511C probably damaging Het
Knstrn T C 2: 118,833,963 probably benign Het
Lrp2 T C 2: 69,552,424 Y39C possibly damaging Het
Minos1 T C 4: 139,105,907 probably benign Het
N4bp2 T C 5: 65,808,114 Y1169H probably benign Het
Olfr178 A T 16: 58,889,806 M138K possibly damaging Het
Olfr671 A C 7: 104,975,982 M1R probably null Het
Olfr843 T C 9: 19,248,743 I219V probably benign Het
Oxct1 T A 15: 4,091,195 F254I probably benign Het
Patj T A 4: 98,454,396 S576T possibly damaging Het
Pdxdc1 A T 16: 13,872,499 C202S probably benign Het
Pet100 A T 8: 3,622,381 I19F probably damaging Het
Pik3r5 T C 11: 68,494,233 Y655H probably damaging Het
Pkhd1 A G 1: 20,081,252 S3807P probably damaging Het
Ptma A G 1: 86,526,927 T8A probably damaging Het
Ptpn3 G T 4: 57,240,843 N257K probably damaging Het
R3hdm1 C A 1: 128,236,672 Q1108K probably benign Het
Rimbp2 T C 5: 128,780,342 D815G probably damaging Het
Scn10a A G 9: 119,694,130 F66L probably benign Het
Selenot T C 3: 58,576,875 probably null Het
Serpinb8 A G 1: 107,598,975 T82A probably benign Het
Serpini2 G A 3: 75,267,988 probably benign Het
Slc1a6 G T 10: 78,795,982 G214V probably benign Het
Slc5a6 C A 5: 31,038,100 A425S probably damaging Het
Smo C A 6: 29,736,124 N38K possibly damaging Het
Smtn A T 11: 3,520,811 C909* probably null Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Stk4 T A 2: 164,099,725 V287E probably benign Het
Tdrd7 A G 4: 46,005,358 D388G possibly damaging Het
Tmem57 T C 4: 134,828,134 I343V probably benign Het
Ttn A T 2: 76,812,308 F13294L probably damaging Het
Ube2j1 T G 4: 33,040,745 F84V probably damaging Het
Ugt3a2 A G 15: 9,370,201 Q477R probably damaging Het
Utf1 T C 7: 139,943,946 S25P probably benign Het
Vmn1r184 A T 7: 26,266,988 H53L probably damaging Het
Vmn2r13 A T 5: 109,191,994 N38K possibly damaging Het
Vps13a C T 19: 16,722,411 D756N probably damaging Het
Vwa1 G T 4: 155,773,238 D34E probably damaging Het
Zfhx2 A C 14: 55,064,317 L2070R probably damaging Het
Zfp984 A G 4: 147,755,905 V163A probably benign Het
Zp3r A T 1: 130,583,471 M325K probably benign Het
Other mutations in Nbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Nbr1 APN 11 101569359 missense possibly damaging 0.91
IGL02192:Nbr1 APN 11 101569591 missense probably damaging 1.00
IGL02259:Nbr1 APN 11 101577990 missense probably damaging 0.99
IGL02951:Nbr1 APN 11 101571979 critical splice donor site probably null
IGL02994:Nbr1 APN 11 101556227 missense probably damaging 1.00
R0087:Nbr1 UTSW 11 101564693 missense probably benign 0.16
R0630:Nbr1 UTSW 11 101567087 unclassified probably benign
R0723:Nbr1 UTSW 11 101576319 nonsense probably null
R0733:Nbr1 UTSW 11 101576371 missense probably benign 0.00
R1482:Nbr1 UTSW 11 101572841 missense probably benign 0.34
R1567:Nbr1 UTSW 11 101575211 missense probably damaging 0.98
R1570:Nbr1 UTSW 11 101564830 unclassified probably benign
R1668:Nbr1 UTSW 11 101569766 missense probably benign 0.00
R1759:Nbr1 UTSW 11 101559543 missense probably damaging 1.00
R1903:Nbr1 UTSW 11 101575152 missense probably damaging 0.98
R1927:Nbr1 UTSW 11 101567214 missense possibly damaging 0.78
R2131:Nbr1 UTSW 11 101566191 unclassified probably null
R2211:Nbr1 UTSW 11 101567264 critical splice donor site probably null
R2255:Nbr1 UTSW 11 101572817 missense possibly damaging 0.80
R4270:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4271:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4710:Nbr1 UTSW 11 101575275 missense probably damaging 1.00
R4947:Nbr1 UTSW 11 101575077 missense probably benign 0.06
R5468:Nbr1 UTSW 11 101572464 missense probably benign 0.10
R5771:Nbr1 UTSW 11 101559538 missense probably damaging 1.00
R6119:Nbr1 UTSW 11 101567112 unclassified probably null
R6400:Nbr1 UTSW 11 101565774 missense probably damaging 1.00
R6603:Nbr1 UTSW 11 101556105 unclassified probably benign
R6943:Nbr1 UTSW 11 101577951 missense probably damaging 1.00
R7347:Nbr1 UTSW 11 101569321 nonsense probably null
R7472:Nbr1 UTSW 11 101571939 missense probably damaging 1.00
R7501:Nbr1 UTSW 11 101566200 missense probably damaging 1.00
R7709:Nbr1 UTSW 11 101556241 missense probably damaging 1.00
R7744:Nbr1 UTSW 11 101569384 missense probably damaging 1.00
R7795:Nbr1 UTSW 11 101569328 missense probably damaging 1.00
X0019:Nbr1 UTSW 11 101567124 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCTAACATTAAGCAAGGAAATCAGC -3'
(R):5'- GTAAATCAAGGCTGCTAGTTTCA -3'

Sequencing Primer
(F):5'- GCTACAGATGCAAGTCCACG -3'
(R):5'- ATCTTGCCATAGGAGCACTG -3'
Posted On2016-10-24