Incidental Mutation 'R2211:Nbr1'
ID 239399
Institutional Source Beutler Lab
Gene Symbol Nbr1
Ensembl Gene ENSMUSG00000017119
Gene Name NBR1, autophagy cargo receptor
Synonyms
MMRRC Submission 040213-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2211 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 101442975-101472777 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 101458090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000071537] [ENSMUST00000071537] [ENSMUST00000103098] [ENSMUST00000103099] [ENSMUST00000107208] [ENSMUST00000107212] [ENSMUST00000107212] [ENSMUST00000107213] [ENSMUST00000107218] [ENSMUST00000107218] [ENSMUST00000123558]
AlphaFold P97432
Predicted Effect probably null
Transcript: ENSMUST00000071537
SMART Domains Protein: ENSMUSP00000071467
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 2.05e-8 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
Pfam:N_BRCA1_IG 378 479 7.1e-34 PFAM
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000071537
SMART Domains Protein: ENSMUSP00000071467
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 2.05e-8 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
Pfam:N_BRCA1_IG 378 479 7.1e-34 PFAM
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000103098
SMART Domains Protein: ENSMUSP00000099387
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000103099
SMART Domains Protein: ENSMUSP00000099388
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107208
SMART Domains Protein: ENSMUSP00000102826
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 1e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107212
SMART Domains Protein: ENSMUSP00000102830
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 3e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 689 719 N/A INTRINSIC
PDB:2MJ5|B 910 956 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107212
SMART Domains Protein: ENSMUSP00000102830
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 3e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 689 719 N/A INTRINSIC
PDB:2MJ5|B 910 956 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107213
SMART Domains Protein: ENSMUSP00000102831
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 677 707 N/A INTRINSIC
PDB:2MJ5|B 898 944 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107218
SMART Domains Protein: ENSMUSP00000102836
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107218
SMART Domains Protein: ENSMUSP00000102836
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000123558
SMART Domains Protein: ENSMUSP00000133619
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127871
Predicted Effect probably null
Transcript: ENSMUST00000149019
SMART Domains Protein: ENSMUSP00000119900
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
coiled coil region 50 89 N/A INTRINSIC
Pfam:N_BRCA1_IG 138 239 2.3e-34 PFAM
low complexity region 267 278 N/A INTRINSIC
coiled coil region 473 500 N/A INTRINSIC
PDB:2MJ5|B 659 705 1e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000149019
SMART Domains Protein: ENSMUSP00000119900
Gene: ENSMUSG00000017119

DomainStartEndE-ValueType
coiled coil region 50 89 N/A INTRINSIC
Pfam:N_BRCA1_IG 138 239 2.3e-34 PFAM
low complexity region 267 278 N/A INTRINSIC
coiled coil region 473 500 N/A INTRINSIC
PDB:2MJ5|B 659 705 1e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149170
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was originally identified as an ovarian tumor antigen monitored in ovarian cancer. The encoded protein contains a B-box/coiled-coil motif, which is present in many genes with transformation potential. It functions as a specific autophagy receptor for the selective autophagic degradation of peroxisomes by forming intracellular inclusions with ubiquitylated autophagic substrates. This gene is located on a region of chromosome 17q21.1 that is in close proximity to the BRCA1 tumor suppressor gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous mice of the genetic truncation allele had an age-dependent increase in bone mass and bone mineral density. Mice homozygous for a floxed allele activated in T cells exhibit decreased ovalbumin-induced inflammation and defective Th2 polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A G 8: 25,118,171 (GRCm39) S34P probably damaging Het
Adam23 T A 1: 63,612,288 (GRCm39) probably benign Het
Adcy10 A T 1: 165,345,781 (GRCm39) I277F probably damaging Het
Arfgef3 A T 10: 18,467,993 (GRCm39) S1736T possibly damaging Het
Arhgap21 A T 2: 20,886,451 (GRCm39) M242K possibly damaging Het
Arhgef18 T C 8: 3,437,680 (GRCm39) S268P possibly damaging Het
Astn1 A G 1: 158,484,876 (GRCm39) R4G probably benign Het
AU041133 G A 10: 81,986,755 (GRCm39) C135Y probably damaging Het
Cdc42bpb A G 12: 111,268,288 (GRCm39) V53A probably benign Het
Cdh23 T C 10: 60,301,783 (GRCm39) D428G possibly damaging Het
Cebpa T C 7: 34,819,891 (GRCm39) S350P probably damaging Het
Cftr A G 6: 18,214,279 (GRCm39) M152V probably null Het
Cpa4 A G 6: 30,583,649 (GRCm39) N255S possibly damaging Het
Ddx51 T A 5: 110,803,634 (GRCm39) D343E probably damaging Het
Dnah7a T C 1: 53,518,932 (GRCm39) I2942V probably benign Het
Dnajc1 G T 2: 18,397,286 (GRCm39) A9E probably damaging Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Edem3 A G 1: 151,680,453 (GRCm39) D526G possibly damaging Het
Emc10 G A 7: 44,142,616 (GRCm39) R109W probably damaging Het
Etaa1 G A 11: 17,902,686 (GRCm39) Q84* probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam149a G A 8: 45,794,046 (GRCm39) T674I probably damaging Het
Fam98a A G 17: 75,845,940 (GRCm39) probably null Het
Fat4 A G 3: 38,945,676 (GRCm39) N1523S possibly damaging Het
Fbxw10 A G 11: 62,758,361 (GRCm39) T529A probably damaging Het
Gzf1 C T 2: 148,526,870 (GRCm39) A447V probably damaging Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hic1 T A 11: 75,060,210 (GRCm39) R46W possibly damaging Het
Id4 T A 13: 48,415,278 (GRCm39) L102Q probably damaging Het
Il3ra T C 14: 14,355,029 (GRCm38) C271R probably benign Het
Ints4 T C 7: 97,158,957 (GRCm39) I443T possibly damaging Het
Lmln A G 16: 32,930,148 (GRCm39) E535G probably benign Het
Lrrtm4 A G 6: 79,999,623 (GRCm39) H345R probably benign Het
Ltbp3 T C 19: 5,803,990 (GRCm39) I834T possibly damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Ms4a18 C A 19: 10,974,669 (GRCm39) V341L probably benign Het
Nf1 T C 11: 79,334,890 (GRCm39) M914T probably benign Het
Notch3 T A 17: 32,366,952 (GRCm39) H861L probably benign Het
Nup58 A G 14: 60,470,089 (GRCm39) F341L probably damaging Het
Ogfod2 C A 5: 124,250,843 (GRCm39) probably null Het
Oit3 T C 10: 59,263,892 (GRCm39) D414G probably damaging Het
Or6c5c A T 10: 129,298,809 (GRCm39) K88M probably damaging Het
Or6c6c A G 10: 129,541,320 (GRCm39) H191R probably benign Het
Or8k32 T C 2: 86,368,857 (GRCm39) Y132C probably damaging Het
Or9q2 T A 19: 13,772,733 (GRCm39) M81L probably benign Het
Pals1 A T 12: 78,844,022 (GRCm39) K75N possibly damaging Het
Pcbp4 C A 9: 106,337,933 (GRCm39) H74Q probably benign Het
Pip5k1b A T 19: 24,356,214 (GRCm39) D241E probably damaging Het
Plcb2 T C 2: 118,554,015 (GRCm39) D102G probably benign Het
Plekha5 G A 6: 140,471,587 (GRCm39) E4K possibly damaging Het
Ppargc1a A C 5: 51,631,601 (GRCm39) S343A possibly damaging Het
Ppwd1 G A 13: 104,343,650 (GRCm39) S585L probably benign Het
Rarg T C 15: 102,147,959 (GRCm39) N284S probably benign Het
Rnpepl1 C T 1: 92,844,102 (GRCm39) L278F probably damaging Het
Rp1 A C 1: 4,418,362 (GRCm39) S917A probably damaging Het
Rsf1 ATGGCG ATGGCGAGGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Rsph3b T C 17: 7,209,139 (GRCm39) S189G probably benign Het
Sec31b A T 19: 44,511,589 (GRCm39) L604Q probably damaging Het
Sema6b T A 17: 56,431,741 (GRCm39) I641F probably benign Het
Slc35f5 A T 1: 125,507,001 (GRCm39) I309F possibly damaging Het
Smarca4 A G 9: 21,597,325 (GRCm39) E1360G probably damaging Het
Spata31d1c T C 13: 65,183,753 (GRCm39) S432P probably benign Het
Spsb3 T C 17: 25,109,911 (GRCm39) probably null Het
Sptbn4 T C 7: 27,067,034 (GRCm39) D1960G probably damaging Het
Srgap1 A G 10: 121,689,645 (GRCm39) V345A possibly damaging Het
Tiam2 C A 17: 3,465,193 (GRCm39) C307* probably null Het
Trim43b T A 9: 88,967,302 (GRCm39) T444S possibly damaging Het
Trmt13 A G 3: 116,388,403 (GRCm39) I11T probably benign Het
Ylpm1 A T 12: 85,091,152 (GRCm39) R1073* probably null Het
Zfp524 T C 7: 5,020,918 (GRCm39) S149P probably damaging Het
Zfp777 T C 6: 48,020,819 (GRCm39) I312V possibly damaging Het
Other mutations in Nbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Nbr1 APN 11 101,460,185 (GRCm39) missense possibly damaging 0.91
IGL02192:Nbr1 APN 11 101,460,417 (GRCm39) missense probably damaging 1.00
IGL02259:Nbr1 APN 11 101,468,816 (GRCm39) missense probably damaging 0.99
IGL02951:Nbr1 APN 11 101,462,805 (GRCm39) critical splice donor site probably null
IGL02994:Nbr1 APN 11 101,447,053 (GRCm39) missense probably damaging 1.00
R0087:Nbr1 UTSW 11 101,455,519 (GRCm39) missense probably benign 0.16
R0630:Nbr1 UTSW 11 101,457,913 (GRCm39) unclassified probably benign
R0723:Nbr1 UTSW 11 101,467,145 (GRCm39) nonsense probably null
R0733:Nbr1 UTSW 11 101,467,197 (GRCm39) missense probably benign 0.00
R1482:Nbr1 UTSW 11 101,463,667 (GRCm39) missense probably benign 0.34
R1567:Nbr1 UTSW 11 101,466,037 (GRCm39) missense probably damaging 0.98
R1570:Nbr1 UTSW 11 101,455,656 (GRCm39) unclassified probably benign
R1668:Nbr1 UTSW 11 101,460,592 (GRCm39) missense probably benign 0.00
R1759:Nbr1 UTSW 11 101,450,369 (GRCm39) missense probably damaging 1.00
R1903:Nbr1 UTSW 11 101,465,978 (GRCm39) missense probably damaging 0.98
R1927:Nbr1 UTSW 11 101,458,040 (GRCm39) missense possibly damaging 0.78
R2131:Nbr1 UTSW 11 101,457,017 (GRCm39) splice site probably null
R2255:Nbr1 UTSW 11 101,463,643 (GRCm39) missense possibly damaging 0.80
R4270:Nbr1 UTSW 11 101,458,048 (GRCm39) missense possibly damaging 0.87
R4271:Nbr1 UTSW 11 101,458,048 (GRCm39) missense possibly damaging 0.87
R4710:Nbr1 UTSW 11 101,466,101 (GRCm39) missense probably damaging 1.00
R4947:Nbr1 UTSW 11 101,465,903 (GRCm39) missense probably benign 0.06
R5468:Nbr1 UTSW 11 101,463,290 (GRCm39) missense probably benign 0.10
R5554:Nbr1 UTSW 11 101,455,633 (GRCm39) missense probably benign 0.34
R5771:Nbr1 UTSW 11 101,450,364 (GRCm39) missense probably damaging 1.00
R6119:Nbr1 UTSW 11 101,457,938 (GRCm39) splice site probably null
R6400:Nbr1 UTSW 11 101,456,600 (GRCm39) missense probably damaging 1.00
R6603:Nbr1 UTSW 11 101,446,931 (GRCm39) unclassified probably benign
R6943:Nbr1 UTSW 11 101,468,777 (GRCm39) missense probably damaging 1.00
R7347:Nbr1 UTSW 11 101,460,147 (GRCm39) nonsense probably null
R7472:Nbr1 UTSW 11 101,462,765 (GRCm39) missense probably damaging 1.00
R7501:Nbr1 UTSW 11 101,457,026 (GRCm39) missense probably damaging 1.00
R7709:Nbr1 UTSW 11 101,447,067 (GRCm39) missense probably damaging 1.00
R7744:Nbr1 UTSW 11 101,460,210 (GRCm39) missense probably damaging 1.00
R7795:Nbr1 UTSW 11 101,460,154 (GRCm39) missense probably damaging 1.00
R8865:Nbr1 UTSW 11 101,455,520 (GRCm39) missense probably benign 0.00
R9377:Nbr1 UTSW 11 101,456,590 (GRCm39) missense possibly damaging 0.95
R9615:Nbr1 UTSW 11 101,465,978 (GRCm39) missense probably benign 0.02
R9667:Nbr1 UTSW 11 101,451,261 (GRCm39) missense possibly damaging 0.68
R9801:Nbr1 UTSW 11 101,447,025 (GRCm39) missense probably damaging 0.99
X0019:Nbr1 UTSW 11 101,457,950 (GRCm39) missense possibly damaging 0.50
Z1176:Nbr1 UTSW 11 101,463,380 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCCTATGCCCATCCTACAAC -3'
(R):5'- AGTGCTGGGGATTACATCTGATT -3'

Sequencing Primer
(F):5'- TGCCCATCCTACAACATTTGTGAAG -3'
(R):5'- TGTGCCTGATGCTCACAAAAG -3'
Posted On 2014-10-15