Incidental Mutation 'R5554:Btn1a1'
ID435307
Institutional Source Beutler Lab
Gene Symbol Btn1a1
Ensembl Gene ENSMUSG00000000706
Gene Namebutyrophilin, subfamily 1, member A1
SynonymsBtn
MMRRC Submission 043111-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5554 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23456992-23465901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23459125 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 385 (F385I)
Ref Sequence ENSEMBL: ENSMUSP00000041013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041674] [ENSMUST00000110434]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041674
AA Change: F385I

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041013
Gene: ENSMUSG00000000706
AA Change: F385I

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
IG_like 150 237 9.03e1 SMART
transmembrane domain 246 268 N/A INTRINSIC
PRY 303 355 2.64e-27 SMART
SPRY 356 477 1.46e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110434
SMART Domains Protein: ENSMUSP00000106064
Gene: ENSMUSG00000000706

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
IGv 46 127 1.97e-11 SMART
Meta Mutation Damage Score 0.2236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. It is a member of the immunoglobulin superfamily. It may have a cell surface receptor function. The human butyrophilin gene is localized in the major histocompatibility complex (MHC) class I region of 6p and may have arisen relatively recently in evolution by the shuffling of exons between 2 ancestral gene families [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired lactation and abnormal lipid accumulation in the mammary gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,413,981 R227L probably benign Het
Adamtsl1 A G 4: 86,276,945 Q533R possibly damaging Het
Adgb C T 10: 10,340,473 R1524H probably damaging Het
Ank2 A T 3: 126,998,973 N739K possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Anxa10 G A 8: 62,061,046 P249L possibly damaging Het
Banp G A 8: 121,991,595 E183K probably damaging Het
BC051665 C G 13: 60,784,621 L83F probably damaging Het
Chchd4 A T 6: 91,465,017 *140R probably null Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dlx2 G A 2: 71,545,461 R173C possibly damaging Het
Dmbt1 C A 7: 131,099,300 Y1069* probably null Het
Dopey1 T A 9: 86,521,657 F1637I probably damaging Het
Dusp18 T C 11: 3,897,202 I64T probably damaging Het
Evi5l A G 8: 4,206,491 probably benign Het
Fam212b T A 3: 105,716,614 S82R possibly damaging Het
Fiz1 T C 7: 5,012,850 H47R probably damaging Het
Fndc3b G T 3: 27,643,013 P17T possibly damaging Het
Foxa1 T A 12: 57,542,291 Q381L probably benign Het
Gda A G 19: 21,428,473 probably null Het
Gm10044 T C 14: 7,771,181 noncoding transcript Het
Gm12258 T A 11: 58,858,468 S156R possibly damaging Het
Gm973 A G 1: 59,526,972 R117G probably benign Het
Grwd1 C T 7: 45,830,640 V48I probably damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Itga1 A T 13: 114,992,474 C549* probably null Het
Kmt2c C A 5: 25,294,610 G511C probably damaging Het
Knstrn T C 2: 118,833,963 probably benign Het
Lrp2 T C 2: 69,552,424 Y39C possibly damaging Het
Minos1 T C 4: 139,105,907 probably benign Het
N4bp2 T C 5: 65,808,114 Y1169H probably benign Het
Nbr1 C T 11: 101,564,807 T129I probably benign Het
Olfr178 A T 16: 58,889,806 M138K possibly damaging Het
Olfr671 A C 7: 104,975,982 M1R probably null Het
Olfr843 T C 9: 19,248,743 I219V probably benign Het
Oxct1 T A 15: 4,091,195 F254I probably benign Het
Patj T A 4: 98,454,396 S576T possibly damaging Het
Pdxdc1 A T 16: 13,872,499 C202S probably benign Het
Pet100 A T 8: 3,622,381 I19F probably damaging Het
Pik3r5 T C 11: 68,494,233 Y655H probably damaging Het
Pkhd1 A G 1: 20,081,252 S3807P probably damaging Het
Ptma A G 1: 86,526,927 T8A probably damaging Het
Ptpn3 G T 4: 57,240,843 N257K probably damaging Het
R3hdm1 C A 1: 128,236,672 Q1108K probably benign Het
Rimbp2 T C 5: 128,780,342 D815G probably damaging Het
Scn10a A G 9: 119,694,130 F66L probably benign Het
Selenot T C 3: 58,576,875 probably null Het
Serpinb8 A G 1: 107,598,975 T82A probably benign Het
Serpini2 G A 3: 75,267,988 probably benign Het
Slc1a6 G T 10: 78,795,982 G214V probably benign Het
Slc5a6 C A 5: 31,038,100 A425S probably damaging Het
Smo C A 6: 29,736,124 N38K possibly damaging Het
Smtn A T 11: 3,520,811 C909* probably null Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Stk4 T A 2: 164,099,725 V287E probably benign Het
Tdrd7 A G 4: 46,005,358 D388G possibly damaging Het
Tmem57 T C 4: 134,828,134 I343V probably benign Het
Ttn A T 2: 76,812,308 F13294L probably damaging Het
Ube2j1 T G 4: 33,040,745 F84V probably damaging Het
Ugt3a2 A G 15: 9,370,201 Q477R probably damaging Het
Utf1 T C 7: 139,943,946 S25P probably benign Het
Vmn1r184 A T 7: 26,266,988 H53L probably damaging Het
Vmn2r13 A T 5: 109,191,994 N38K possibly damaging Het
Vps13a C T 19: 16,722,411 D756N probably damaging Het
Vwa1 G T 4: 155,773,238 D34E probably damaging Het
Zfhx2 A C 14: 55,064,317 L2070R probably damaging Het
Zfp984 A G 4: 147,755,905 V163A probably benign Het
Zp3r A T 1: 130,583,471 M325K probably benign Het
Other mutations in Btn1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Btn1a1 APN 13 23461737 missense possibly damaging 0.56
IGL01608:Btn1a1 APN 13 23461608 missense probably benign 0.00
IGL02538:Btn1a1 APN 13 23459215 missense possibly damaging 0.50
IGL02795:Btn1a1 APN 13 23460616 critical splice acceptor site probably null
IGL02933:Btn1a1 APN 13 23460527 missense possibly damaging 0.63
R0063:Btn1a1 UTSW 13 23465097 splice site probably null
R0855:Btn1a1 UTSW 13 23464319 missense probably damaging 1.00
R1754:Btn1a1 UTSW 13 23460468 missense probably benign 0.01
R2122:Btn1a1 UTSW 13 23461521 missense probably damaging 1.00
R3110:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3112:Btn1a1 UTSW 13 23461551 missense possibly damaging 0.67
R3941:Btn1a1 UTSW 13 23459264 missense probably benign 0.01
R4169:Btn1a1 UTSW 13 23465155 missense probably benign
R4924:Btn1a1 UTSW 13 23464226 splice site probably benign
R4927:Btn1a1 UTSW 13 23460624 splice site probably null
R5255:Btn1a1 UTSW 13 23464154 intron probably benign
R5726:Btn1a1 UTSW 13 23459352 missense probably damaging 1.00
R6228:Btn1a1 UTSW 13 23464351 missense probably damaging 0.98
R6664:Btn1a1 UTSW 13 23459320 missense probably benign 0.00
R7117:Btn1a1 UTSW 13 23459245 missense possibly damaging 0.91
R7150:Btn1a1 UTSW 13 23459351 missense probably damaging 1.00
R7151:Btn1a1 UTSW 13 23459313 missense probably damaging 1.00
R7396:Btn1a1 UTSW 13 23461498 missense probably benign 0.01
R7504:Btn1a1 UTSW 13 23461716 missense probably benign 0.10
R7874:Btn1a1 UTSW 13 23459215 missense possibly damaging 0.50
R7878:Btn1a1 UTSW 13 23459044 missense possibly damaging 0.86
R7957:Btn1a1 UTSW 13 23459215 missense possibly damaging 0.50
R7961:Btn1a1 UTSW 13 23459044 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTGAACAGATGGTCAGGGGC -3'
(R):5'- AAGATTCACGTCAGATCCTGC -3'

Sequencing Primer
(F):5'- TCAGGGGCTTTTTACCACAGGAC -3'
(R):5'- ACGTCAGATCCTGCCTGATAG -3'
Posted On2016-10-24