Incidental Mutation 'R5554:Patj'
ID435274
Institutional Source Beutler Lab
Gene Symbol Patj
Ensembl Gene ENSMUSG00000061859
Gene NamePATJ, crumbs cell polarity complex component
SynonymsInadl, Cipp
MMRRC Submission 043111-MU
Accession Numbers

Genbank: NM_172696; MGI: 1277960

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5554 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location98395785-98719603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98454396 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 576 (S576T)
Ref Sequence ENSEMBL: ENSMUSP00000102645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041284] [ENSMUST00000107029] [ENSMUST00000107030] [ENSMUST00000107033] [ENSMUST00000107034]
PDB Structure
Overall structure of Patj/Pals1/Mals complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000041284
SMART Domains Protein: ENSMUSP00000049176
Gene: ENSMUSG00000061859

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 570 641 1.28e-12 SMART
PDZ 696 775 9.5e-16 SMART
low complexity region 980 991 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
PDZ 1083 1166 8.65e-19 SMART
PDZ 1253 1328 6.12e-19 SMART
low complexity region 1356 1366 N/A INTRINSIC
low complexity region 1410 1428 N/A INTRINSIC
PDZ 1480 1555 4.36e-24 SMART
PDZ 1577 1650 2.49e-19 SMART
PDZ 1718 1795 2.13e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107029
SMART Domains Protein: ENSMUSP00000102644
Gene: ENSMUSG00000061859

DomainStartEndE-ValueType
PDZ 1 68 1e-9 SMART
PDZ 123 202 4.7e-18 SMART
low complexity region 407 418 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
PDZ 510 593 4.3e-21 SMART
PDZ 680 755 2.9e-21 SMART
low complexity region 783 793 N/A INTRINSIC
low complexity region 837 855 N/A INTRINSIC
PDZ 907 982 2.2e-26 SMART
PDZ 1004 1077 1.2e-21 SMART
PDZ 1145 1222 1e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107030
AA Change: S576T

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102645
Gene: ENSMUSG00000061859
AA Change: S576T

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107033
SMART Domains Protein: ENSMUSP00000102648
Gene: ENSMUSG00000061859

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
low complexity region 648 659 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
PDZ 751 834 8.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107034
SMART Domains Protein: ENSMUSP00000102649
Gene: ENSMUSG00000061859

DomainStartEndE-ValueType
L27 8 68 6.53e-9 SMART
PDZ 143 221 1.78e-20 SMART
PDZ 256 328 1.15e-23 SMART
PDZ 374 453 3.15e-21 SMART
coiled coil region 486 513 N/A INTRINSIC
PDZ 566 637 1.28e-12 SMART
PDZ 692 771 9.5e-16 SMART
low complexity region 976 987 N/A INTRINSIC
low complexity region 1050 1058 N/A INTRINSIC
PDZ 1079 1162 8.65e-19 SMART
PDZ 1249 1324 6.12e-19 SMART
low complexity region 1352 1362 N/A INTRINSIC
low complexity region 1382 1400 N/A INTRINSIC
PDZ 1452 1499 7.78e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142103
SMART Domains Protein: ENSMUSP00000116021
Gene: ENSMUSG00000061859

DomainStartEndE-ValueType
PDZ 49 120 1.28e-12 SMART
PDZ 175 254 9.5e-16 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: This gene encodes a multivalent PDZ domain protein, which is expressed exclusively in brain and kidney. This protein selectively interacts with inward rectifier K+ (Kir) family members, N-methyl-D-aspartate receptor subunits, neurexins and neuroligins, as well as cell surface molecules enriched in synaptic membranes. Thus, this protein may serve as a scaffold that brings structurally diverse but functionally connected proteins into close proximity at the synapse. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,413,981 R227L probably benign Het
Adamtsl1 A G 4: 86,276,945 Q533R possibly damaging Het
Adgb C T 10: 10,340,473 R1524H probably damaging Het
Ank2 A T 3: 126,998,973 N739K possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Anxa10 G A 8: 62,061,046 P249L possibly damaging Het
Banp G A 8: 121,991,595 E183K probably damaging Het
BC051665 C G 13: 60,784,621 L83F probably damaging Het
Btn1a1 A T 13: 23,459,125 F385I possibly damaging Het
Chchd4 A T 6: 91,465,017 *140R probably null Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dlx2 G A 2: 71,545,461 R173C possibly damaging Het
Dmbt1 C A 7: 131,099,300 Y1069* probably null Het
Dopey1 T A 9: 86,521,657 F1637I probably damaging Het
Dusp18 T C 11: 3,897,202 I64T probably damaging Het
Evi5l A G 8: 4,206,491 probably benign Het
Fam212b T A 3: 105,716,614 S82R possibly damaging Het
Fiz1 T C 7: 5,012,850 H47R probably damaging Het
Fndc3b G T 3: 27,643,013 P17T possibly damaging Het
Foxa1 T A 12: 57,542,291 Q381L probably benign Het
Gda A G 19: 21,428,473 probably null Het
Gm10044 T C 14: 7,771,181 noncoding transcript Het
Gm12258 T A 11: 58,858,468 S156R possibly damaging Het
Gm973 A G 1: 59,526,972 R117G probably benign Het
Grwd1 C T 7: 45,830,640 V48I probably damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Itga1 A T 13: 114,992,474 C549* probably null Het
Kmt2c C A 5: 25,294,610 G511C probably damaging Het
Knstrn T C 2: 118,833,963 probably benign Het
Lrp2 T C 2: 69,552,424 Y39C possibly damaging Het
Minos1 T C 4: 139,105,907 probably benign Het
N4bp2 T C 5: 65,808,114 Y1169H probably benign Het
Nbr1 C T 11: 101,564,807 T129I probably benign Het
Olfr178 A T 16: 58,889,806 M138K possibly damaging Het
Olfr671 A C 7: 104,975,982 M1R probably null Het
Olfr843 T C 9: 19,248,743 I219V probably benign Het
Oxct1 T A 15: 4,091,195 F254I probably benign Het
Pdxdc1 A T 16: 13,872,499 C202S probably benign Het
Pet100 A T 8: 3,622,381 I19F probably damaging Het
Pik3r5 T C 11: 68,494,233 Y655H probably damaging Het
Pkhd1 A G 1: 20,081,252 S3807P probably damaging Het
Ptma A G 1: 86,526,927 T8A probably damaging Het
Ptpn3 G T 4: 57,240,843 N257K probably damaging Het
R3hdm1 C A 1: 128,236,672 Q1108K probably benign Het
Rimbp2 T C 5: 128,780,342 D815G probably damaging Het
Scn10a A G 9: 119,694,130 F66L probably benign Het
Selenot T C 3: 58,576,875 probably null Het
Serpinb8 A G 1: 107,598,975 T82A probably benign Het
Serpini2 G A 3: 75,267,988 probably benign Het
Slc1a6 G T 10: 78,795,982 G214V probably benign Het
Slc5a6 C A 5: 31,038,100 A425S probably damaging Het
Smo C A 6: 29,736,124 N38K possibly damaging Het
Smtn A T 11: 3,520,811 C909* probably null Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Stk4 T A 2: 164,099,725 V287E probably benign Het
Tdrd7 A G 4: 46,005,358 D388G possibly damaging Het
Tmem57 T C 4: 134,828,134 I343V probably benign Het
Ttn A T 2: 76,812,308 F13294L probably damaging Het
Ube2j1 T G 4: 33,040,745 F84V probably damaging Het
Ugt3a2 A G 15: 9,370,201 Q477R probably damaging Het
Utf1 T C 7: 139,943,946 S25P probably benign Het
Vmn1r184 A T 7: 26,266,988 H53L probably damaging Het
Vmn2r13 A T 5: 109,191,994 N38K possibly damaging Het
Vps13a C T 19: 16,722,411 D756N probably damaging Het
Vwa1 G T 4: 155,773,238 D34E probably damaging Het
Zfhx2 A C 14: 55,064,317 L2070R probably damaging Het
Zfp984 A G 4: 147,755,905 V163A probably benign Het
Zp3r A T 1: 130,583,471 M325K probably benign Het
Other mutations in Patj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Patj APN 4 98465106 missense probably damaging 1.00
IGL00095:Patj APN 4 98535562 missense possibly damaging 0.78
IGL00517:Patj APN 4 98441071 missense possibly damaging 0.95
IGL00802:Patj APN 4 98424406 missense possibly damaging 0.93
IGL01064:Patj APN 4 98496973 missense possibly damaging 0.95
IGL01110:Patj APN 4 98413024 missense probably damaging 0.99
IGL01407:Patj APN 4 98413050 missense possibly damaging 0.49
IGL01821:Patj APN 4 98456211 missense probably damaging 1.00
IGL02399:Patj APN 4 98591936 missense probably damaging 1.00
IGL02494:Patj APN 4 98703987 splice site probably benign
IGL02803:Patj APN 4 98426064 missense probably damaging 0.99
IGL02931:Patj APN 4 98411173 splice site probably benign
IGL03017:Patj APN 4 98465027 splice site probably benign
IGL03115:Patj APN 4 98443803 missense probably damaging 1.00
IGL03209:Patj APN 4 98465140 missense probably null 1.00
IGL03377:Patj APN 4 98465104 missense probably damaging 1.00
D4186:Patj UTSW 4 98638762 missense probably benign 0.17
PIT4531001:Patj UTSW 4 98441090 missense probably damaging 0.98
R0136:Patj UTSW 4 98667648 missense probably damaging 1.00
R0294:Patj UTSW 4 98497048 missense probably damaging 0.99
R0376:Patj UTSW 4 98568987 missense probably damaging 1.00
R0463:Patj UTSW 4 98674308 missense probably damaging 1.00
R0465:Patj UTSW 4 98535507 splice site probably null
R0466:Patj UTSW 4 98688156 missense probably damaging 1.00
R0544:Patj UTSW 4 98569110 missense probably damaging 1.00
R0624:Patj UTSW 4 98681235 splice site probably benign
R0657:Patj UTSW 4 98667648 missense probably damaging 1.00
R1281:Patj UTSW 4 98416695 missense probably damaging 1.00
R1393:Patj UTSW 4 98424411 missense probably benign 0.01
R1480:Patj UTSW 4 98469582 missense probably damaging 1.00
R1667:Patj UTSW 4 98413027 missense probably damaging 1.00
R1728:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1729:Patj UTSW 4 98431780 missense possibly damaging 0.50
R1797:Patj UTSW 4 98687438 missense probably damaging 1.00
R1818:Patj UTSW 4 98623648 missense possibly damaging 0.85
R1835:Patj UTSW 4 98491590 missense probably benign 0.00
R1880:Patj UTSW 4 98497240 missense probably benign 0.00
R2009:Patj UTSW 4 98456169 missense probably damaging 1.00
R2090:Patj UTSW 4 98437323 unclassified probably benign
R2120:Patj UTSW 4 98456225 missense probably benign 0.01
R2180:Patj UTSW 4 98523502 critical splice donor site probably null
R2655:Patj UTSW 4 98437450 missense possibly damaging 0.64
R3156:Patj UTSW 4 98674228 missense probably damaging 1.00
R3749:Patj UTSW 4 98469600 missense probably damaging 1.00
R3767:Patj UTSW 4 98681219 nonsense probably null
R3913:Patj UTSW 4 98569101 missense probably damaging 0.99
R3917:Patj UTSW 4 98592008 nonsense probably null
R3918:Patj UTSW 4 98456218 missense probably damaging 1.00
R4299:Patj UTSW 4 98677321 missense possibly damaging 0.89
R4355:Patj UTSW 4 98650454 missense possibly damaging 0.87
R4471:Patj UTSW 4 98535579 missense probably damaging 1.00
R4762:Patj UTSW 4 98405570 nonsense probably null
R4877:Patj UTSW 4 98569058 missense possibly damaging 0.94
R4945:Patj UTSW 4 98495064 missense probably damaging 0.97
R5274:Patj UTSW 4 98518981 missense probably damaging 0.99
R5343:Patj UTSW 4 98676193 missense probably damaging 1.00
R5688:Patj UTSW 4 98520810 nonsense probably null
R5880:Patj UTSW 4 98411145 missense probably damaging 0.96
R5972:Patj UTSW 4 98569053 missense probably damaging 0.98
R6149:Patj UTSW 4 98424325 missense possibly damaging 0.72
R6192:Patj UTSW 4 98456157 missense probably damaging 1.00
R6265:Patj UTSW 4 98469567 missense probably benign 0.08
R6350:Patj UTSW 4 98405618 missense probably benign 0.26
R6363:Patj UTSW 4 98431860 missense probably benign 0.25
R6434:Patj UTSW 4 98491629 missense probably damaging 1.00
R6496:Patj UTSW 4 98416752 missense probably damaging 1.00
R6896:Patj UTSW 4 98426050 missense possibly damaging 0.87
R7039:Patj UTSW 4 98569078 missense probably damaging 0.96
R7040:Patj UTSW 4 98441080 missense probably benign 0.02
R7052:Patj UTSW 4 98677260 missense probably benign 0.03
R7066:Patj UTSW 4 98413197 missense probably benign 0.24
R7236:Patj UTSW 4 98411057 missense probably damaging 1.00
R7242:Patj UTSW 4 98591933 missense probably benign 0.26
R7260:Patj UTSW 4 98416733 missense possibly damaging 0.94
R7412:Patj UTSW 4 98411139 missense probably damaging 0.98
R7493:Patj UTSW 4 98495061 missense probably benign 0.41
R7570:Patj UTSW 4 98424500 splice site probably null
R7571:Patj UTSW 4 98568980 missense probably damaging 1.00
R7626:Patj UTSW 4 98546987 missense probably benign 0.35
R7658:Patj UTSW 4 98688179 missense probably damaging 1.00
R7664:Patj UTSW 4 98496950 missense possibly damaging 0.92
R7669:Patj UTSW 4 98518942 missense probably damaging 1.00
R7796:Patj UTSW 4 98546983 start codon destroyed probably benign 0.05
R7870:Patj UTSW 4 98424316 missense probably damaging 1.00
R7883:Patj UTSW 4 98611135 missense probably benign 0.00
R7948:Patj UTSW 4 98424310 missense probably damaging 0.99
R7953:Patj UTSW 4 98424316 missense probably damaging 1.00
R7966:Patj UTSW 4 98611135 missense probably benign 0.00
R8050:Patj UTSW 4 98538964 missense probably benign 0.00
Z1176:Patj UTSW 4 98611130 missense probably benign 0.11
Z1176:Patj UTSW 4 98676318 nonsense probably null
Z1177:Patj UTSW 4 98497174 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAGAAGTCGCACACACTTGC -3'
(R):5'- CGTGCATTGCAGATAAGACATTG -3'

Sequencing Primer
(F):5'- GCTTGTCACTAGCAGCCATG -3'
(R):5'- TCTTACATCTTCAGGAGCCAGGG -3'
Posted On2016-10-24