Incidental Mutation 'R5554:Olfr178'
ID435315
Institutional Source Beutler Lab
Gene Symbol Olfr178
Ensembl Gene ENSMUSG00000044029
Gene Nameolfactory receptor 178
SynonymsGA_x54KRFPKG5P-55108059-55107100, MOR184-6
MMRRC Submission 043111-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5554 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58888308-58892063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58889806 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 138 (M138K)
Ref Sequence ENSEMBL: ENSMUSP00000148922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058564] [ENSMUST00000206523] [ENSMUST00000215032]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058564
AA Change: M138K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049578
Gene: ENSMUSG00000044029
AA Change: M138K

DomainStartEndE-ValueType
Pfam:7tm_4 33 306 1.2e-49 PFAM
Pfam:7TM_GPCR_Srsx 37 262 4.4e-7 PFAM
Pfam:7tm_1 43 312 5.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206523
AA Change: M138K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215032
AA Change: M138K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.5876 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 C A 11: 101,413,981 R227L probably benign Het
Adamtsl1 A G 4: 86,276,945 Q533R possibly damaging Het
Adgb C T 10: 10,340,473 R1524H probably damaging Het
Ank2 A T 3: 126,998,973 N739K possibly damaging Het
Ankrd39 C T 1: 36,541,981 G96R probably damaging Het
Anxa10 G A 8: 62,061,046 P249L possibly damaging Het
Banp G A 8: 121,991,595 E183K probably damaging Het
BC051665 C G 13: 60,784,621 L83F probably damaging Het
Btn1a1 A T 13: 23,459,125 F385I possibly damaging Het
Chchd4 A T 6: 91,465,017 *140R probably null Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dlx2 G A 2: 71,545,461 R173C possibly damaging Het
Dmbt1 C A 7: 131,099,300 Y1069* probably null Het
Dopey1 T A 9: 86,521,657 F1637I probably damaging Het
Dusp18 T C 11: 3,897,202 I64T probably damaging Het
Evi5l A G 8: 4,206,491 probably benign Het
Fam212b T A 3: 105,716,614 S82R possibly damaging Het
Fiz1 T C 7: 5,012,850 H47R probably damaging Het
Fndc3b G T 3: 27,643,013 P17T possibly damaging Het
Foxa1 T A 12: 57,542,291 Q381L probably benign Het
Gda A G 19: 21,428,473 probably null Het
Gm10044 T C 14: 7,771,181 noncoding transcript Het
Gm12258 T A 11: 58,858,468 S156R possibly damaging Het
Gm973 A G 1: 59,526,972 R117G probably benign Het
Grwd1 C T 7: 45,830,640 V48I probably damaging Het
Ifi209 T A 1: 173,641,197 S198T probably benign Het
Itga1 A T 13: 114,992,474 C549* probably null Het
Kmt2c C A 5: 25,294,610 G511C probably damaging Het
Knstrn T C 2: 118,833,963 probably benign Het
Lrp2 T C 2: 69,552,424 Y39C possibly damaging Het
Minos1 T C 4: 139,105,907 probably benign Het
N4bp2 T C 5: 65,808,114 Y1169H probably benign Het
Nbr1 C T 11: 101,564,807 T129I probably benign Het
Olfr671 A C 7: 104,975,982 M1R probably null Het
Olfr843 T C 9: 19,248,743 I219V probably benign Het
Oxct1 T A 15: 4,091,195 F254I probably benign Het
Patj T A 4: 98,454,396 S576T possibly damaging Het
Pdxdc1 A T 16: 13,872,499 C202S probably benign Het
Pet100 A T 8: 3,622,381 I19F probably damaging Het
Pik3r5 T C 11: 68,494,233 Y655H probably damaging Het
Pkhd1 A G 1: 20,081,252 S3807P probably damaging Het
Ptma A G 1: 86,526,927 T8A probably damaging Het
Ptpn3 G T 4: 57,240,843 N257K probably damaging Het
R3hdm1 C A 1: 128,236,672 Q1108K probably benign Het
Rimbp2 T C 5: 128,780,342 D815G probably damaging Het
Scn10a A G 9: 119,694,130 F66L probably benign Het
Selenot T C 3: 58,576,875 probably null Het
Serpinb8 A G 1: 107,598,975 T82A probably benign Het
Serpini2 G A 3: 75,267,988 probably benign Het
Slc1a6 G T 10: 78,795,982 G214V probably benign Het
Slc5a6 C A 5: 31,038,100 A425S probably damaging Het
Smo C A 6: 29,736,124 N38K possibly damaging Het
Smtn A T 11: 3,520,811 C909* probably null Het
Sntg2 C T 12: 30,258,041 R215H probably benign Het
Stk4 T A 2: 164,099,725 V287E probably benign Het
Tdrd7 A G 4: 46,005,358 D388G possibly damaging Het
Tmem57 T C 4: 134,828,134 I343V probably benign Het
Ttn A T 2: 76,812,308 F13294L probably damaging Het
Ube2j1 T G 4: 33,040,745 F84V probably damaging Het
Ugt3a2 A G 15: 9,370,201 Q477R probably damaging Het
Utf1 T C 7: 139,943,946 S25P probably benign Het
Vmn1r184 A T 7: 26,266,988 H53L probably damaging Het
Vmn2r13 A T 5: 109,191,994 N38K possibly damaging Het
Vps13a C T 19: 16,722,411 D756N probably damaging Het
Vwa1 G T 4: 155,773,238 D34E probably damaging Het
Zfhx2 A C 14: 55,064,317 L2070R probably damaging Het
Zfp984 A G 4: 147,755,905 V163A probably benign Het
Zp3r A T 1: 130,583,471 M325K probably benign Het
Other mutations in Olfr178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Olfr178 APN 16 58889685 missense probably damaging 0.97
IGL01964:Olfr178 APN 16 58889464 missense probably damaging 0.97
IGL02122:Olfr178 APN 16 58889771 missense probably benign
IGL02183:Olfr178 APN 16 58889821 missense probably benign 0.00
IGL03143:Olfr178 APN 16 58889461 missense probably damaging 1.00
R1566:Olfr178 UTSW 16 58889540 missense probably damaging 1.00
R2324:Olfr178 UTSW 16 58890140 missense probably benign
R2420:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R2421:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R2422:Olfr178 UTSW 16 58889965 missense probably benign 0.00
R4256:Olfr178 UTSW 16 58889780 missense probably benign 0.21
R4374:Olfr178 UTSW 16 58889879 missense probably benign 0.13
R4502:Olfr178 UTSW 16 58890176 missense probably benign 0.02
R4503:Olfr178 UTSW 16 58890176 missense probably benign 0.02
R4662:Olfr178 UTSW 16 58889924 missense probably damaging 1.00
R4967:Olfr178 UTSW 16 58889594 missense possibly damaging 0.48
R5206:Olfr178 UTSW 16 58890018 missense probably damaging 0.99
R5285:Olfr178 UTSW 16 58890108 nonsense probably null
R5477:Olfr178 UTSW 16 58889744 missense probably benign 0.10
R5723:Olfr178 UTSW 16 58889613 nonsense probably null
R5725:Olfr178 UTSW 16 58889887 missense possibly damaging 0.64
R6853:Olfr178 UTSW 16 58889758 missense possibly damaging 0.64
R6853:Olfr178 UTSW 16 58889759 missense probably damaging 0.99
R7238:Olfr178 UTSW 16 58889889 missense probably damaging 1.00
R7554:Olfr178 UTSW 16 58889406 missense probably benign 0.27
R7577:Olfr178 UTSW 16 58889266 missense probably benign 0.22
R7787:Olfr178 UTSW 16 58889590 missense probably benign
R8008:Olfr178 UTSW 16 58889888 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGGTCTGTACAGGAGAGTC -3'
(R):5'- CATGTACATCTTTCTGGGCAAC -3'

Sequencing Primer
(F):5'- GGGTCTGTACAGGAGAGTCTATAC -3'
(R):5'- AACCTGGCTCTGATGGACTC -3'
Posted On2016-10-24