Incidental Mutation 'R5595:Olfr605'
ID437772
Institutional Source Beutler Lab
Gene Symbol Olfr605
Ensembl Gene ENSMUSG00000109659
Gene Nameolfactory receptor 605
SynonymsGA_x6K02T2PBJ9-6164792-6163848, MOR24-5, MOR202-22P
MMRRC Submission 043147-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5595 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103440407-103445439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103442428 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 232 (S232T)
Ref Sequence ENSEMBL: ENSMUSP00000151125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080660] [ENSMUST00000215417]
Predicted Effect probably damaging
Transcript: ENSMUST00000080660
AA Change: S232T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079489
Gene: ENSMUSG00000109659
AA Change: S232T

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 8.6e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 305 1.9e-9 PFAM
Pfam:7tm_1 43 294 6.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215417
AA Change: S232T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik T C 16: 4,864,279 F991S probably benign Het
4931406B18Rik A G 7: 43,497,872 I218T possibly damaging Het
4931440F15Rik T C 11: 29,824,288 N390D probably benign Het
9930111J21Rik2 C T 11: 49,019,711 A632T possibly damaging Het
Akt1 A T 12: 112,658,616 L166Q probably null Het
Alpk2 A T 18: 65,266,248 D2086E probably damaging Het
Ankrd11 A T 8: 122,894,304 C915* probably null Het
Ankrd44 A T 1: 54,735,050 I398K probably damaging Het
Ankrd44 T C 1: 54,762,347 T274A probably damaging Het
Arhgef2 A G 3: 88,642,976 T663A probably benign Het
BC048403 T C 10: 121,740,147 probably benign Het
Btbd16 G A 7: 130,823,303 M471I possibly damaging Het
Btbd16 C A 7: 130,823,304 Q472K probably damaging Het
Cdc37 G A 9: 21,143,213 R39C probably damaging Het
Cnnm1 A G 19: 43,465,157 N537S possibly damaging Het
Cop1 T A 1: 159,250,073 D159E probably benign Het
Crtac1 C T 19: 42,413,951 V73I probably benign Het
Cryz T A 3: 154,606,518 V84E probably damaging Het
Ctnnd2 C T 15: 30,669,543 L433F probably benign Het
Ctsq C A 13: 61,037,060 D271Y probably benign Het
Cyp3a25 A C 5: 145,994,863 probably null Het
Dmbt1 G C 7: 131,054,067 W412C probably benign Het
Eif4e1b G A 13: 54,786,716 V131I possibly damaging Het
Epha1 A G 6: 42,364,634 V494A possibly damaging Het
Fbxl4 T C 4: 22,433,641 S593P probably damaging Het
Fbxo41 G A 6: 85,479,901 P429S probably benign Het
Fgfr3 G A 5: 33,730,003 C204Y probably damaging Het
Gbf1 T C 19: 46,284,422 V1665A possibly damaging Het
Htt T A 5: 34,905,397 V2825E probably damaging Het
Irs1 A T 1: 82,289,925 V190E probably damaging Het
Klk1 T C 7: 44,228,737 probably null Het
Kmt2d T C 15: 98,850,024 probably benign Het
Meox1 T C 11: 101,879,343 E186G probably damaging Het
Micu2 G A 14: 57,971,744 R86W probably damaging Het
Mrgprb1 A T 7: 48,447,684 I160K probably damaging Het
Nckap1l T A 15: 103,475,658 M561K possibly damaging Het
Olfr1199 A T 2: 88,756,405 I90N probably damaging Het
Olfr689 A T 7: 105,314,006 M1L probably benign Het
Otoa T A 7: 121,121,977 L405H probably damaging Het
Phyhip A T 14: 70,466,874 M178L probably benign Het
Pkd1l3 A T 8: 109,655,520 N1630I probably damaging Het
Plek2 T A 12: 78,894,109 T247S probably benign Het
Rhbdl3 T C 11: 80,337,583 V293A probably damaging Het
Rock2 T A 12: 16,942,809 F193Y probably damaging Het
Scn3a C T 2: 65,460,713 M1896I probably benign Het
Snrnp200 T C 2: 127,226,013 V810A probably damaging Het
Taar4 G A 10: 23,960,741 S83N probably damaging Het
Tdpoz4 A T 3: 93,797,499 T368S probably benign Het
Tec T A 5: 72,768,744 I322F possibly damaging Het
Teddm2 T C 1: 153,850,400 I190V probably benign Het
Tmem117 A G 15: 95,094,884 E475G probably damaging Het
Trip10 T A 17: 57,262,460 Y495N probably damaging Het
Ush2a T C 1: 188,906,498 V4035A possibly damaging Het
Utrn C T 10: 12,682,318 V1466M possibly damaging Het
Vasp A G 7: 19,257,891 probably benign Het
Vmn1r89 A T 7: 13,219,930 M130L possibly damaging Het
Vmn2r2 A T 3: 64,126,615 D495E possibly damaging Het
Zfp213 A G 17: 23,561,186 V120A possibly damaging Het
Other mutations in Olfr605
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Olfr605 APN 7 103442952 missense probably damaging 1.00
IGL03219:Olfr605 APN 7 103442538 missense possibly damaging 0.51
IGL03265:Olfr605 APN 7 103442448 missense probably benign 0.18
IGL03404:Olfr605 APN 7 103442988 missense possibly damaging 0.78
R0294:Olfr605 UTSW 7 103443084 missense possibly damaging 0.77
R0465:Olfr605 UTSW 7 103442835 missense possibly damaging 0.67
R4698:Olfr605 UTSW 7 103442635 missense possibly damaging 0.88
R4758:Olfr605 UTSW 7 103442869 missense probably damaging 1.00
R5447:Olfr605 UTSW 7 103442940 missense probably damaging 0.99
R7196:Olfr605 UTSW 7 103442997 missense probably benign 0.15
R7202:Olfr605 UTSW 7 103443085 missense probably benign 0.00
R7291:Olfr605 UTSW 7 103442788 missense probably benign 0.00
R7636:Olfr605 UTSW 7 103442833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGAAAGGGCGGTACCAG -3'
(R):5'- TCTCACCAACAGTCGCATCG -3'

Sequencing Primer
(F):5'- CCAGAAGGTACATATTGGCTATGAAG -3'
(R):5'- TACTGCAGAACTCGAATCATTGC -3'
Posted On2016-10-26