Incidental Mutation 'P4717OSA:Ube2e2'
ID44003
Institutional Source Beutler Lab
Gene Symbol Ube2e2
Ensembl Gene ENSMUSG00000058317
Gene Nameubiquitin-conjugating enzyme E2E 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location18573575-18894267 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 18630297 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076133] [ENSMUST00000076133] [ENSMUST00000124353] [ENSMUST00000150727] [ENSMUST00000151926] [ENSMUST00000175643] [ENSMUST00000176555] [ENSMUST00000176843]
Predicted Effect probably null
Transcript: ENSMUST00000076133
SMART Domains Protein: ENSMUSP00000075495
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
UBCc 58 201 2.41e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076133
SMART Domains Protein: ENSMUSP00000075495
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
UBCc 58 201 2.41e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124353
SMART Domains Protein: ENSMUSP00000114162
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
Pfam:UQ_con 59 108 1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135381
Predicted Effect probably null
Transcript: ENSMUST00000150727
SMART Domains Protein: ENSMUSP00000115738
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
UBCc 58 201 2.41e-71 SMART
Predicted Effect probably null
Transcript: ENSMUST00000151926
SMART Domains Protein: ENSMUSP00000118321
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
UBCc 82 181 6.81e-30 SMART
Predicted Effect probably null
Transcript: ENSMUST00000175643
SMART Domains Protein: ENSMUSP00000135674
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
UBCc 10 167 9.19e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176555
SMART Domains Protein: ENSMUSP00000134919
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:3BZH|A 28 84 8e-6 PDB
SCOP:d2e2c__ 49 85 5e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176843
SMART Domains Protein: ENSMUSP00000135622
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
UBCc 7 146 1.09e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177259
SMART Domains Protein: ENSMUSP00000135573
Gene: ENSMUSG00000058317

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
Pfam:UQ_con 59 118 1.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177398
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Other mutations in Ube2e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P4748:Ube2e2 UTSW 14 18630297 critical splice donor site probably null
R0717:Ube2e2 UTSW 14 18888435 missense probably benign 0.00
R0799:Ube2e2 UTSW 14 18630393 nonsense probably null
R1671:Ube2e2 UTSW 14 18586889 missense probably damaging 1.00
R2973:Ube2e2 UTSW 14 18630321 missense possibly damaging 0.96
R5941:Ube2e2 UTSW 14 18586910 missense probably damaging 1.00
R7397:Ube2e2 UTSW 14 18630339 missense probably damaging 1.00
R7657:Ube2e2 UTSW 14 18586997 missense probably benign 0.30
R8027:Ube2e2 UTSW 14 18574317 missense possibly damaging 0.54
X0018:Ube2e2 UTSW 14 18586923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGACCCTGGAGTAATTCCAC -3'
(R):5'- GAGCAGTACAACAGGACCTTCGAC -3'

Sequencing Primer
(F):5'- CACTTACATGGCTGGAATATGG -3'
(R):5'- CGACTCTGCTGGATTACATAATGC -3'
Posted On2013-05-31