Incidental Mutation 'P4717OSA:Mcoln3'
ID43991
Institutional Source Beutler Lab
Gene Symbol Mcoln3
Ensembl Gene ENSMUSG00000036853
Gene Namemucolipin 3
Synonymsvaritint-waddler, Va, 6720490O21Rik, TRPML3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location146117450-146141806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 146124749 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 78 (V78G)
Ref Sequence ENSEMBL: ENSMUSP00000115655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039450] [ENSMUST00000140214]
Predicted Effect probably damaging
Transcript: ENSMUST00000039450
AA Change: V78G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038801
Gene: ENSMUSG00000036853
AA Change: V78G

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Pfam:PKD_channel 360 508 3.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140214
AA Change: V78G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115655
Gene: ENSMUSG00000036853
AA Change: V78G

DomainStartEndE-ValueType
low complexity region 24 29 N/A INTRINSIC
transmembrane domain 63 82 N/A INTRINSIC
Meta Mutation Damage Score 0.9380 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of members of the mucolipin cation channel proteins. Mutation studies of the highly similar protein in mice have shown that the protein is found in cochlea hair cells, and mutant mice show early-onset hearing loss and balance problems. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Heterozygotes show normal/diluted/white hair patches, circling, hyperactivity, deafness, and reduced fertility. Homozygotes are white with small patches of color and show severe behavioral abnormalities, poor postnatal viability and are nearly infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Tmed4 T C 11: 6,273,727 probably benign Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Mcoln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mcoln3 APN 3 146133928 missense probably damaging 1.00
IGL01106:Mcoln3 APN 3 146137264 missense probably benign 0.01
IGL01712:Mcoln3 APN 3 146128264 unclassified probably benign
IGL02115:Mcoln3 APN 3 146137301 missense probably damaging 0.99
IGL02116:Mcoln3 APN 3 146133909 missense probably benign 0.29
R0463:Mcoln3 UTSW 3 146140576 nonsense probably null
R1981:Mcoln3 UTSW 3 146140590 nonsense probably null
R2056:Mcoln3 UTSW 3 146128224 missense probably benign 0.01
R3000:Mcoln3 UTSW 3 146133907 missense possibly damaging 0.62
R4366:Mcoln3 UTSW 3 146140492 missense possibly damaging 0.76
R4667:Mcoln3 UTSW 3 146131204 missense probably benign 0.01
R4950:Mcoln3 UTSW 3 146139519 missense probably damaging 0.96
R5457:Mcoln3 UTSW 3 146128122 missense probably benign 0.00
R6302:Mcoln3 UTSW 3 146124772 missense probably benign 0.00
R6353:Mcoln3 UTSW 3 146131154 missense probably damaging 0.99
R6632:Mcoln3 UTSW 3 146128187 missense probably benign
R6915:Mcoln3 UTSW 3 146137256 critical splice acceptor site probably null
R7790:Mcoln3 UTSW 3 146139492 missense probably damaging 1.00
R7838:Mcoln3 UTSW 3 146139475 missense probably damaging 1.00
R7861:Mcoln3 UTSW 3 146124791 missense possibly damaging 0.95
Z1176:Mcoln3 UTSW 3 146140466 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTGTGTCCCCATAGTCATACTGG -3'
(R):5'- AGCCTGTTCTTTCTCCCAAGAATGC -3'

Sequencing Primer
(F):5'- tgtctgtggttctagggatttg -3'
(R):5'- ccttgatacctaaaacagacagac -3'
Posted On2013-05-31