Incidental Mutation 'R5513:Rbm15b'
ID440188
Institutional Source Beutler Lab
Gene Symbol Rbm15b
Ensembl Gene ENSMUSG00000074102
Gene NameRNA binding motif protein 15B
Synonyms
MMRRC Submission 043073-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R5513 (G1)
Quality Score158
Status Validated
Chromosome9
Chromosomal Location106880918-106887428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106886117 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 284 (L284P)
Ref Sequence ENSEMBL: ENSMUSP00000059330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055843] [ENSMUST00000069036] [ENSMUST00000159283]
PDB Structure
Solution structure of the RNA recognition motif from hypothetical RNA binding protein BC052180 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055843
AA Change: L284P

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000059330
Gene: ENSMUSG00000074102
AA Change: L284P

DomainStartEndE-ValueType
low complexity region 5 41 N/A INTRINSIC
low complexity region 53 75 N/A INTRINSIC
low complexity region 78 133 N/A INTRINSIC
RRM 137 212 2.47e-2 SMART
low complexity region 216 251 N/A INTRINSIC
low complexity region 266 299 N/A INTRINSIC
RRM 334 406 2.03e-15 SMART
RRM 415 484 3.57e-11 SMART
low complexity region 653 675 N/A INTRINSIC
Pfam:SPOC 719 854 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069036
SMART Domains Protein: ENSMUSP00000066534
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 13 165 3.2e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159283
SMART Domains Protein: ENSMUSP00000124562
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Armet 26 171 9.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160503
SMART Domains Protein: ENSMUSP00000124453
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 17 118 1.6e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160978
SMART Domains Protein: ENSMUSP00000124791
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Armet 26 124 1.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161272
SMART Domains Protein: ENSMUSP00000125424
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 1 51 2.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162801
Predicted Effect probably benign
Transcript: ENSMUST00000185707
Meta Mutation Damage Score 0.1080 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15B, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,750,973 V1130I probably damaging Het
Abtb2 A T 2: 103,709,278 probably null Het
Akr1b3 C A 6: 34,316,646 probably benign Het
Alppl2 T A 1: 87,087,338 N434Y probably benign Het
Ampd2 A G 3: 108,075,667 I648T possibly damaging Het
Ankrd11 T C 8: 122,892,520 E1510G probably benign Het
Ano2 A C 6: 126,039,322 K939N possibly damaging Het
Arhgef5 A G 6: 43,272,339 Y8C probably damaging Het
Aspm A T 1: 139,482,398 I2609F probably damaging Het
Camsap2 A T 1: 136,280,863 S964T probably benign Het
Cd22 C T 7: 30,867,025 R823Q probably damaging Het
Cd74 T C 18: 60,811,305 C196R probably damaging Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Cidec A T 6: 113,428,179 Y177N probably damaging Het
Crb1 C T 1: 139,236,821 probably null Het
Cts7 T C 13: 61,355,584 K189E possibly damaging Het
Cyp2c68 A T 19: 39,703,406 Y358N probably damaging Het
Dab2ip A T 2: 35,710,254 H294L probably benign Het
Dnah6 T C 6: 73,190,419 D502G probably null Het
Dnah8 T A 17: 30,752,916 M2768K probably damaging Het
Etl4 C A 2: 20,743,827 S405R probably damaging Het
Fsip2 G T 2: 82,950,908 L19F probably damaging Het
Fsip2 C G 2: 82,950,912 Q217E probably benign Het
Fsip2 T A 2: 82,985,198 N3758K possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hivep2 A T 10: 14,132,673 K1672* probably null Het
Igkv2-137 G A 6: 67,556,014 G54S possibly damaging Het
Ints8 A G 4: 11,248,303 V105A possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Lrrc8b A G 5: 105,485,984 K774R probably damaging Het
Mcm4 T A 16: 15,630,514 Y393F probably benign Het
Mki67 A G 7: 135,707,750 L324P probably damaging Het
Olfr12 T C 1: 92,620,380 V158A probably benign Het
Olfr1428 A G 19: 12,109,381 L55P probably damaging Het
Olfr1441 G A 19: 12,422,683 V125I probably benign Het
Olfr665 A T 7: 104,881,499 H264L probably damaging Het
Pld4 A G 12: 112,762,554 E19G probably benign Het
Plvap T C 8: 71,511,529 E63G probably damaging Het
Ppig A G 2: 69,750,359 T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 143,135,893 probably benign Het
Rhbdl3 T C 11: 80,331,842 V239A probably damaging Het
Sae1 T C 7: 16,366,856 E197G probably benign Het
Sdhaf2 C T 19: 10,517,030 R105H probably damaging Het
Senp3 T C 11: 69,677,139 D425G probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc46a1 T C 11: 78,466,550 F143S probably benign Het
Tom1 T A 8: 75,057,220 N52K probably damaging Het
Vmn1r11 A T 6: 57,137,632 T94S probably damaging Het
Zfp236 A G 18: 82,658,022 I390T probably damaging Het
Zfp709 A T 8: 71,890,056 H443L probably damaging Het
Zfp960 C T 17: 17,087,734 P237S possibly damaging Het
Other mutations in Rbm15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Rbm15b APN 9 106885709 missense probably damaging 1.00
IGL02514:Rbm15b APN 9 106884977 missense probably damaging 0.96
IGL02585:Rbm15b APN 9 106885826 missense probably benign 0.22
IGL02814:Rbm15b APN 9 106885776 missense probably benign 0.12
IGL03110:Rbm15b APN 9 106885974 missense probably damaging 1.00
IGL03335:Rbm15b APN 9 106884339 missense probably damaging 0.99
R0004:Rbm15b UTSW 9 106884936 missense probably benign 0.02
R0234:Rbm15b UTSW 9 106885364 missense probably damaging 1.00
R0234:Rbm15b UTSW 9 106885364 missense probably damaging 1.00
R0390:Rbm15b UTSW 9 106885998 missense probably benign 0.03
R1981:Rbm15b UTSW 9 106881623 unclassified probably benign
R2966:Rbm15b UTSW 9 106885592 missense probably damaging 1.00
R4085:Rbm15b UTSW 9 106885737 missense possibly damaging 0.80
R4890:Rbm15b UTSW 9 106885829 missense possibly damaging 0.86
R5081:Rbm15b UTSW 9 106884921 missense probably benign 0.01
R5118:Rbm15b UTSW 9 106886102 missense possibly damaging 0.65
R7341:Rbm15b UTSW 9 106885047 missense probably benign 0.35
R7711:Rbm15b UTSW 9 106885943 missense possibly damaging 0.67
R7842:Rbm15b UTSW 9 106885889 missense probably damaging 1.00
R7925:Rbm15b UTSW 9 106885889 missense probably damaging 1.00
X0024:Rbm15b UTSW 9 106885379 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GTTGCCGATGAAGAGGTTTC -3'
(R):5'- TTCCACCAGTTCAAGCGGTTC -3'

Sequencing Primer
(F):5'- CGAGTGGCTCTCTGATCATC -3'
(R):5'- TACGTGAACTTCCGGCAC -3'
Posted On2016-11-08