Incidental Mutation 'R5513:Senp3'
ID440190
Institutional Source Beutler Lab
Gene Symbol Senp3
Ensembl Gene ENSMUSG00000005204
Gene NameSUMO/sentrin specific peptidase 3
SynonymsSmt3ip1
MMRRC Submission 043073-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R5513 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69673115-69682084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69677139 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 425 (D425G)
Ref Sequence ENSEMBL: ENSMUSP00000066581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005336] [ENSMUST00000066760] [ENSMUST00000102589] [ENSMUST00000163666]
Predicted Effect probably benign
Transcript: ENSMUST00000005336
AA Change: D425G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005336
Gene: ENSMUSG00000005204
AA Change: D425G

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066760
AA Change: D425G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066581
Gene: ENSMUSG00000005204
AA Change: D425G

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130440
Predicted Effect probably benign
Transcript: ENSMUST00000134942
SMART Domains Protein: ENSMUSP00000114791
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
Pfam:Peptidase_C48 5 167 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144033
Predicted Effect probably benign
Transcript: ENSMUST00000163666
SMART Domains Protein: ENSMUSP00000127034
Gene: ENSMUSG00000059796

DomainStartEndE-ValueType
DEXDc 51 249 3.61e-60 SMART
HELICc 286 367 1.04e-33 SMART
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP3, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,750,973 V1130I probably damaging Het
Abtb2 A T 2: 103,709,278 probably null Het
Akr1b3 C A 6: 34,316,646 probably benign Het
Alppl2 T A 1: 87,087,338 N434Y probably benign Het
Ampd2 A G 3: 108,075,667 I648T possibly damaging Het
Ankrd11 T C 8: 122,892,520 E1510G probably benign Het
Ano2 A C 6: 126,039,322 K939N possibly damaging Het
Arhgef5 A G 6: 43,272,339 Y8C probably damaging Het
Aspm A T 1: 139,482,398 I2609F probably damaging Het
Camsap2 A T 1: 136,280,863 S964T probably benign Het
Cd22 C T 7: 30,867,025 R823Q probably damaging Het
Cd74 T C 18: 60,811,305 C196R probably damaging Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Cidec A T 6: 113,428,179 Y177N probably damaging Het
Crb1 C T 1: 139,236,821 probably null Het
Cts7 T C 13: 61,355,584 K189E possibly damaging Het
Cyp2c68 A T 19: 39,703,406 Y358N probably damaging Het
Dab2ip A T 2: 35,710,254 H294L probably benign Het
Dnah6 T C 6: 73,190,419 D502G probably null Het
Dnah8 T A 17: 30,752,916 M2768K probably damaging Het
Etl4 C A 2: 20,743,827 S405R probably damaging Het
Fsip2 G T 2: 82,950,908 L19F probably damaging Het
Fsip2 C G 2: 82,950,912 Q217E probably benign Het
Fsip2 T A 2: 82,985,198 N3758K possibly damaging Het
Gm12689 T C 4: 99,296,165 I85T unknown Het
Hivep2 A T 10: 14,132,673 K1672* probably null Het
Igkv2-137 G A 6: 67,556,014 G54S possibly damaging Het
Ints8 A G 4: 11,248,303 V105A possibly damaging Het
Lrba C T 3: 86,542,641 S2089F probably damaging Het
Lrrc8b A G 5: 105,485,984 K774R probably damaging Het
Mcm4 T A 16: 15,630,514 Y393F probably benign Het
Mki67 A G 7: 135,707,750 L324P probably damaging Het
Olfr12 T C 1: 92,620,380 V158A probably benign Het
Olfr1428 A G 19: 12,109,381 L55P probably damaging Het
Olfr1441 G A 19: 12,422,683 V125I probably benign Het
Olfr665 A T 7: 104,881,499 H264L probably damaging Het
Pld4 A G 12: 112,762,554 E19G probably benign Het
Plvap T C 8: 71,511,529 E63G probably damaging Het
Ppig A G 2: 69,750,359 T746A probably benign Het
Prdm2 GCTCCTCCTCCTCCTCCTCCTCCTC GCTCCTCCTCCTCCTCCTCCTC 4: 143,135,893 probably benign Het
Rbm15b A G 9: 106,886,117 L284P probably benign Het
Rhbdl3 T C 11: 80,331,842 V239A probably damaging Het
Sae1 T C 7: 16,366,856 E197G probably benign Het
Sdhaf2 C T 19: 10,517,030 R105H probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc46a1 T C 11: 78,466,550 F143S probably benign Het
Tom1 T A 8: 75,057,220 N52K probably damaging Het
Vmn1r11 A T 6: 57,137,632 T94S probably damaging Het
Zfp236 A G 18: 82,658,022 I390T probably damaging Het
Zfp709 A T 8: 71,890,056 H443L probably damaging Het
Zfp960 C T 17: 17,087,734 P237S possibly damaging Het
Other mutations in Senp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Senp3 APN 11 69674093 missense possibly damaging 0.50
IGL02227:Senp3 APN 11 69674530 missense possibly damaging 0.95
IGL02942:Senp3 APN 11 69677989 missense probably benign 0.02
IGL02996:Senp3 APN 11 69674260 missense probably damaging 1.00
R0784:Senp3 UTSW 11 69680448 missense probably damaging 0.99
R2474:Senp3 UTSW 11 69674097 missense probably damaging 1.00
R4619:Senp3 UTSW 11 69677118 missense probably benign 0.00
R4620:Senp3 UTSW 11 69677118 missense probably benign 0.00
R4737:Senp3 UTSW 11 69678829 nonsense probably null
R4777:Senp3 UTSW 11 69678237 missense probably damaging 1.00
R4824:Senp3 UTSW 11 69677995 missense probably benign 0.16
R5870:Senp3 UTSW 11 69678222 splice site probably null
R7206:Senp3 UTSW 11 69678731 missense probably benign 0.08
R7735:Senp3 UTSW 11 69678261 missense probably damaging 0.99
R8724:Senp3 UTSW 11 69673593 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTTTCTACAATCACGCCTG -3'
(R):5'- GTTTGGTTAAATTGGGACAGGAAC -3'

Sequencing Primer
(F):5'- GTTTCTACAATCACGCCTGATACAC -3'
(R):5'- GGTTAAATTGGGACAGGAACTTATC -3'
Posted On2016-11-08