Incidental Mutation 'R0004:Rbm15b'
ID32399
Institutional Source Beutler Lab
Gene Symbol Rbm15b
Ensembl Gene ENSMUSG00000074102
Gene NameRNA binding motif protein 15B
Synonyms
MMRRC Submission 038300-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.527) question?
Stock #R0004 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location106880918-106887428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106884936 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 678 (T678A)
Ref Sequence ENSEMBL: ENSMUSP00000059330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055009] [ENSMUST00000055843] [ENSMUST00000069036] [ENSMUST00000159283] [ENSMUST00000159645] [ENSMUST00000161758]
PDB Structure
Solution structure of the RNA recognition motif from hypothetical RNA binding protein BC052180 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055009
SMART Domains Protein: ENSMUSP00000060025
Gene: ENSMUSG00000040325

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1392 N/A PDB
SCOP:d1tbga_ 1063 1375 9e-20 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1393 1452 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
PDB:4P7I|D 1484 1506 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000055843
AA Change: T678A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000059330
Gene: ENSMUSG00000074102
AA Change: T678A

DomainStartEndE-ValueType
low complexity region 5 41 N/A INTRINSIC
low complexity region 53 75 N/A INTRINSIC
low complexity region 78 133 N/A INTRINSIC
RRM 137 212 2.47e-2 SMART
low complexity region 216 251 N/A INTRINSIC
low complexity region 266 299 N/A INTRINSIC
RRM 334 406 2.03e-15 SMART
RRM 415 484 3.57e-11 SMART
low complexity region 653 675 N/A INTRINSIC
Pfam:SPOC 719 854 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069036
SMART Domains Protein: ENSMUSP00000066534
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 13 165 3.2e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159283
SMART Domains Protein: ENSMUSP00000124562
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Armet 26 171 9.1e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159620
SMART Domains Protein: ENSMUSP00000123907
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 18 120 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159645
SMART Domains Protein: ENSMUSP00000123865
Gene: ENSMUSG00000040325

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1394 N/A PDB
SCOP:d1tbga_ 1063 1375 1e-19 SMART
Blast:WD40 1078 1120 2e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1395 1402 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160503
SMART Domains Protein: ENSMUSP00000124453
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 17 118 1.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161272
SMART Domains Protein: ENSMUSP00000125424
Gene: ENSMUSG00000032575

DomainStartEndE-ValueType
Pfam:Armet 1 51 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161758
SMART Domains Protein: ENSMUSP00000125730
Gene: ENSMUSG00000040325

DomainStartEndE-ValueType
low complexity region 175 191 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 591 605 N/A INTRINSIC
LisH 845 877 1.77e-3 SMART
low complexity region 920 945 N/A INTRINSIC
PDB:4PXW|B 1038 1398 N/A PDB
SCOP:d1tbga_ 1063 1308 3e-19 SMART
Blast:WD40 1078 1120 3e-22 BLAST
Blast:WD40 1123 1164 7e-19 BLAST
low complexity region 1399 1458 N/A INTRINSIC
low complexity region 1463 1489 N/A INTRINSIC
PDB:4P7I|D 1490 1512 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000163657
Predicted Effect silent
Transcript: ENSMUST00000185707
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SPEN (Split-end) family of proteins, including RBM15B, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T C 2: 121,152,485 I86T probably damaging Het
Aff3 T C 1: 38,269,726 D376G possibly damaging Het
Akap11 A T 14: 78,514,940 H164Q possibly damaging Het
Akap12 A T 10: 4,353,220 D10V probably damaging Het
Arhgap32 T C 9: 32,151,998 V101A probably damaging Het
Atm A T 9: 53,453,528 probably benign Het
Ccdc18 A G 5: 108,161,700 D387G possibly damaging Het
Ccdc38 A T 10: 93,574,102 Q261L probably damaging Het
Cd180 T G 13: 102,702,708 V33G probably benign Het
Cd207 G A 6: 83,674,248 Q242* probably null Het
Cnp T C 11: 100,576,807 F192S probably damaging Het
Colec10 G T 15: 54,410,875 R33L possibly damaging Het
Csn1s1 A T 5: 87,671,531 M16L probably benign Het
Dnah10 A T 5: 124,726,902 M98L probably benign Het
Dnah17 T C 11: 118,060,092 I2902V possibly damaging Het
Dtnb A G 12: 3,596,635 probably benign Het
Epha5 T C 5: 84,331,842 Y101C probably damaging Het
Ephb2 T A 4: 136,657,524 M860L probably damaging Het
Fbxw18 T C 9: 109,701,313 T77A probably damaging Het
Fgfbp3 A G 19: 36,918,682 S179P possibly damaging Het
Foxp2 A G 6: 15,197,096 T45A possibly damaging Het
Gckr A T 5: 31,297,589 probably benign Het
Glce T A 9: 62,068,579 Q213L probably damaging Het
Gm1965 A C 6: 89,146,487 H84P unknown Het
Hbegf A G 18: 36,507,506 V166A probably damaging Het
Helb G T 10: 120,108,981 H217N probably damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kansl2 A G 15: 98,520,376 L392P probably damaging Het
Klra1 A T 6: 130,372,873 Y201N probably damaging Het
Klra3 A G 6: 130,323,687 S240P probably damaging Het
Liph T A 16: 21,984,194 R42* probably null Het
Lrp1 A T 10: 127,541,825 probably null Het
Luc7l2 A T 6: 38,589,234 K52M probably damaging Het
Mecom G A 3: 29,979,911 P215S probably damaging Het
Myo1g T A 11: 6,515,901 T395S probably damaging Het
Ndst4 T A 3: 125,570,826 M384K probably benign Het
Ndufb2 C T 6: 39,596,504 T51I possibly damaging Het
Nell1 C A 7: 50,560,759 probably benign Het
Olfr639 A T 7: 104,012,431 N90K probably benign Het
Oxr1 G A 15: 41,820,540 S434N possibly damaging Het
Pcdhac2 T A 18: 37,145,237 S423R probably benign Het
Pcdhb10 T A 18: 37,411,959 D29E probably benign Het
Pde10a A G 17: 8,981,576 T1053A probably benign Het
Pkdrej T A 15: 85,818,183 H1184L probably damaging Het
Prkaa2 C T 4: 105,047,091 R263Q probably null Het
Prmt9 A G 8: 77,555,782 I103V possibly damaging Het
Ryr2 T C 13: 11,665,919 Y3180C probably benign Het
Scaf1 T C 7: 45,007,670 probably benign Het
Scn7a T A 2: 66,687,795 N1024I possibly damaging Het
Sec23b T C 2: 144,564,562 probably benign Het
Sf1 C A 19: 6,374,191 P417Q probably damaging Het
Slc4a3 A T 1: 75,557,009 probably benign Het
Stk32a T C 18: 43,305,056 W207R probably damaging Het
Syne1 A T 10: 5,443,132 probably benign Het
Tecta A T 9: 42,345,478 V1634E possibly damaging Het
Tenm2 A G 11: 36,023,357 F2450S probably damaging Het
Tgfb1 T C 7: 25,692,366 probably benign Het
Tpgs2 A G 18: 25,158,238 probably benign Het
Washc5 A G 15: 59,367,467 M149T probably damaging Het
Wrn A T 8: 33,317,560 V290D probably damaging Het
Zbtb41 A G 1: 139,442,888 T688A possibly damaging Het
Zfp560 C T 9: 20,347,967 C533Y probably damaging Het
Zfp791 G A 8: 85,110,866 A123V probably benign Het
Other mutations in Rbm15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Rbm15b APN 9 106885709 missense probably damaging 1.00
IGL02514:Rbm15b APN 9 106884977 missense probably damaging 0.96
IGL02585:Rbm15b APN 9 106885826 missense probably benign 0.22
IGL02814:Rbm15b APN 9 106885776 missense probably benign 0.12
IGL03110:Rbm15b APN 9 106885974 missense probably damaging 1.00
IGL03335:Rbm15b APN 9 106884339 missense probably damaging 0.99
R0234:Rbm15b UTSW 9 106885364 missense probably damaging 1.00
R0234:Rbm15b UTSW 9 106885364 missense probably damaging 1.00
R0390:Rbm15b UTSW 9 106885998 missense probably benign 0.03
R1981:Rbm15b UTSW 9 106881623 unclassified probably benign
R2966:Rbm15b UTSW 9 106885592 missense probably damaging 1.00
R4085:Rbm15b UTSW 9 106885737 missense possibly damaging 0.80
R4890:Rbm15b UTSW 9 106885829 missense possibly damaging 0.86
R5081:Rbm15b UTSW 9 106884921 missense probably benign 0.01
R5118:Rbm15b UTSW 9 106886102 missense possibly damaging 0.65
R5513:Rbm15b UTSW 9 106886117 missense probably benign 0.02
R7341:Rbm15b UTSW 9 106885047 missense probably benign 0.35
R7711:Rbm15b UTSW 9 106885943 missense possibly damaging 0.67
R7842:Rbm15b UTSW 9 106885889 missense probably damaging 1.00
R8327:Rbm15b UTSW 9 106884447 missense probably benign 0.00
R8372:Rbm15b UTSW 9 106885563 missense
X0024:Rbm15b UTSW 9 106885379 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TTGAGGAGGCCACTGATAACTCCC -3'
(R):5'- CCAGCCTCAGTAAAAGTTCAGACCG -3'

Sequencing Primer
(F):5'- TGGTCCCCCTCAAGGATG -3'
(R):5'- TATAGCCGCTCAGTTCGCAG -3'
Posted On2013-05-09