Incidental Mutation 'R5870:Senp3'
ID455142
Institutional Source Beutler Lab
Gene Symbol Senp3
Ensembl Gene ENSMUSG00000005204
Gene NameSUMO/sentrin specific peptidase 3
SynonymsSmt3ip1
MMRRC Submission 044078-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R5870 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69673115-69682084 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 69678222 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000005336] [ENSMUST00000018896] [ENSMUST00000066760] [ENSMUST00000108648] [ENSMUST00000174159] [ENSMUST00000180587]
Predicted Effect probably benign
Transcript: ENSMUST00000005336
AA Change: R371K

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005336
Gene: ENSMUSG00000005204
AA Change: R371K

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018896
SMART Domains Protein: ENSMUSP00000018896
Gene: ENSMUSG00000089669

DomainStartEndE-ValueType
Blast:TNF 39 87 1e-22 BLAST
low complexity region 101 106 N/A INTRINSIC
TNF 107 240 7.41e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066760
AA Change: R371K

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066581
Gene: ENSMUSG00000005204
AA Change: R371K

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108648
SMART Domains Protein: ENSMUSP00000104288
Gene: ENSMUSG00000089669

DomainStartEndE-ValueType
Blast:TNF 39 87 1e-22 BLAST
TNF 97 224 6.21e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130440
Predicted Effect probably null
Transcript: ENSMUST00000134942
SMART Domains Protein: ENSMUSP00000114791
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
Pfam:Peptidase_C48 5 167 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153516
Predicted Effect probably benign
Transcript: ENSMUST00000174159
SMART Domains Protein: ENSMUSP00000133951
Gene: ENSMUSG00000018752

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
TNF 117 255 6.18e-10 SMART
low complexity region 269 274 N/A INTRINSIC
TNF 275 408 7.41e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180587
SMART Domains Protein: ENSMUSP00000137973
Gene: ENSMUSG00000018752

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
TNF 118 256 6.18e-10 SMART
low complexity region 270 275 N/A INTRINSIC
TNF 276 410 1.91e-2 SMART
Meta Mutation Damage Score 0.1975 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 93% (84/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP3, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,368 V156A probably damaging Het
Ak6 C A 13: 100,655,424 P125Q probably damaging Het
Aqp4 A C 18: 15,399,889 V49G probably damaging Het
Arfgef1 A G 1: 10,180,938 I874T probably damaging Het
Arid1a T C 4: 133,681,076 D2040G unknown Het
Atp1a3 T G 7: 24,997,578 D220A probably benign Het
C2cd4c A T 10: 79,612,209 I368N possibly damaging Het
Ccnt1 G A 15: 98,543,513 Q625* probably null Het
Cd177 T A 7: 24,756,332 H255L probably benign Het
Cdipt G A 7: 126,978,922 V114M probably benign Het
Coro1b T A 19: 4,149,385 H14Q probably damaging Het
Ctdp1 T A 18: 80,408,686 D158V unknown Het
Cts7 A T 13: 61,355,731 S140T probably damaging Het
Dlgap3 T A 4: 127,195,709 L366* probably null Het
Dnah9 C T 11: 66,085,210 A1338T probably benign Het
Dock7 T C 4: 99,063,962 I424V probably benign Het
Dock8 G T 19: 25,132,126 A891S probably benign Het
Elmod3 A G 6: 72,594,738 probably null Het
Eps15 G A 4: 109,361,310 E107K probably damaging Het
Esco1 A T 18: 10,593,744 probably null Het
Fuz A G 7: 44,900,318 T407A probably damaging Het
Galr1 A T 18: 82,406,072 F27I probably benign Het
Glt1d1 A G 5: 127,677,280 Y182C probably damaging Het
Gm37240 A T 3: 84,690,521 probably benign Het
Gm37610 A G 6: 41,084,914 noncoding transcript Het
Gm6658 G T 8: 90,908,392 probably benign Het
Gm9376 A G 14: 118,267,377 T74A possibly damaging Het
Hadha G A 5: 30,144,286 S109F possibly damaging Het
Herc3 A T 6: 58,916,450 Q899L probably benign Het
Ift172 C T 5: 31,276,940 E485K probably benign Het
Lrrc8e A G 8: 4,235,725 K650R possibly damaging Het
Ly6d A T 15: 74,763,532 V10D possibly damaging Het
Med27 A G 2: 29,389,811 probably null Het
Med29 A T 7: 28,392,497 V56E probably damaging Het
Mobp A G 9: 120,167,853 K17E probably damaging Het
Mrpl37 G A 4: 107,066,722 T25I probably benign Het
Myh1 A G 11: 67,201,979 D33G possibly damaging Het
Nrg3 T A 14: 39,472,629 I58F possibly damaging Het
Olfr589 A G 7: 103,155,741 I2T probably benign Het
Olfr872 A G 9: 20,260,578 D246G probably benign Het
Padi1 T A 4: 140,826,581 D359V probably benign Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pgm3 C A 9: 86,570,361 K15N probably damaging Het
Phip A T 9: 82,908,677 probably benign Het
Pot1a G A 6: 25,778,951 T48I possibly damaging Het
Ppic T C 18: 53,409,261 K125R probably benign Het
Ppm1j T C 3: 104,785,495 V440A possibly damaging Het
Prg4 T A 1: 150,455,549 K458* probably null Het
Rd3 A T 1: 191,985,300 M244L probably benign Het
Rflnb A G 11: 76,022,038 Y175H probably benign Het
Rnf157 T A 11: 116,347,074 S574C probably benign Het
Sardh A G 2: 27,220,641 probably null Het
Siglec1 G A 2: 131,072,847 R1450C probably damaging Het
Sim2 A G 16: 94,123,334 H446R probably damaging Het
Spon1 T C 7: 114,031,786 I444T probably damaging Het
Srebf1 T A 11: 60,203,584 Q568H possibly damaging Het
Stxbp4 A T 11: 90,537,956 I441N possibly damaging Het
Sugt1 G A 14: 79,609,011 V163I probably benign Het
Surf1 G T 2: 26,916,259 probably benign Het
Synj2 A G 17: 6,037,853 E1348G probably benign Het
Tc2n A T 12: 101,652,852 V349D probably damaging Het
Ten1 A G 11: 116,214,925 R112G possibly damaging Het
Tm9sf4 A G 2: 153,194,281 D321G probably damaging Het
Ttll12 A T 15: 83,577,036 M594K probably damaging Het
Ttn T A 2: 76,872,714 probably benign Het
Usp28 C T 9: 49,025,985 Q185* probably null Het
Vmn2r112 A G 17: 22,619,023 I822V probably benign Het
Wdr60 A G 12: 116,256,245 S26P possibly damaging Het
Zc3hc1 A T 6: 30,382,683 L88* probably null Het
Zfr T A 15: 12,160,615 V758D probably damaging Het
Zfyve27 T G 19: 42,171,671 L42R probably benign Het
Other mutations in Senp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Senp3 APN 11 69674093 missense possibly damaging 0.50
IGL02227:Senp3 APN 11 69674530 missense possibly damaging 0.95
IGL02942:Senp3 APN 11 69677989 missense probably benign 0.02
IGL02996:Senp3 APN 11 69674260 missense probably damaging 1.00
R0784:Senp3 UTSW 11 69680448 missense probably damaging 0.99
R2474:Senp3 UTSW 11 69674097 missense probably damaging 1.00
R4619:Senp3 UTSW 11 69677118 missense probably benign 0.00
R4620:Senp3 UTSW 11 69677118 missense probably benign 0.00
R4737:Senp3 UTSW 11 69678829 nonsense probably null
R4777:Senp3 UTSW 11 69678237 missense probably damaging 1.00
R4824:Senp3 UTSW 11 69677995 missense probably benign 0.16
R5513:Senp3 UTSW 11 69677139 missense probably benign
R7206:Senp3 UTSW 11 69678731 missense probably benign 0.08
R7735:Senp3 UTSW 11 69678261 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCTGGAGGATGTAGCATG -3'
(R):5'- GCTTGTCCATGAGCATTCTCG -3'

Sequencing Primer
(F):5'- ATGTAGCATGGGGGTGGAG -3'
(R):5'- GGAGACCATCGAAACAACCTGTG -3'
Posted On2017-02-10