Incidental Mutation 'R5650:Slco1a4'
ID441361
Institutional Source Beutler Lab
Gene Symbol Slco1a4
Ensembl Gene ENSMUSG00000030237
Gene Namesolute carrier organic anion transporter family, member 1a4
SynonymsOatp2, Oatp1a4, Slc21a5
MMRRC Submission 043296-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5650 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141805440-141856199 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141809394 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 561 (I561F)
Ref Sequence ENSEMBL: ENSMUSP00000130746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032364] [ENSMUST00000165990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032364
AA Change: I561F

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032364
Gene: ENSMUSG00000030237
AA Change: I561F

DomainStartEndE-ValueType
Pfam:OATP 19 598 3.2e-196 PFAM
Pfam:MFS_1 22 421 9.2e-27 PFAM
Pfam:Kazal_2 445 486 5e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165990
AA Change: I561F

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130746
Gene: ENSMUSG00000030237
AA Change: I561F

DomainStartEndE-ValueType
Pfam:OATP 21 597 3.2e-164 PFAM
Pfam:MFS_1 22 421 7.2e-27 PFAM
Pfam:Kazal_2 445 486 6.8e-11 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T C 6: 85,620,271 L693P probably damaging Het
Ankrd11 T C 8: 122,887,397 T2524A probably damaging Het
Cdr2 A G 7: 120,958,336 I322T probably damaging Het
Cep76 A T 18: 67,625,066 C385S probably damaging Het
Cercam C T 2: 29,881,815 S549F probably damaging Het
Coro1b C T 19: 4,150,611 T209I possibly damaging Het
Dlec1 G T 9: 119,143,594 E1462* probably null Het
Dlgap5 C T 14: 47,411,739 G166D probably benign Het
Ep400 C T 5: 110,695,952 probably null Het
Fgr T G 4: 133,000,222 V478G probably benign Het
Fmo9 T A 1: 166,663,446 I437F probably damaging Het
Gabrd A T 4: 155,388,624 V64E probably damaging Het
Gsap A G 5: 21,251,053 Y385C probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Helz T A 11: 107,595,146 M127K probably null Het
Hist1h4d A T 13: 23,581,795 N65I possibly damaging Het
Hsp90b1 G A 10: 86,693,503 A310V probably damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Kif7 C T 7: 79,710,979 R216H probably damaging Het
Klhl33 A G 14: 50,891,828 I648T probably benign Het
Knl1 T A 2: 119,081,550 L1716* probably null Het
Lgals9 T A 11: 78,973,154 N55I probably damaging Het
Lmo7 A T 14: 101,898,674 T606S probably damaging Het
Mdn1 A G 4: 32,667,467 probably null Het
Mip A T 10: 128,226,065 I62F possibly damaging Het
Naa35 G A 13: 59,622,866 probably benign Het
Npepl1 T C 2: 174,121,536 F454L possibly damaging Het
Oit1 A T 14: 8,357,142 V96E probably damaging Het
Olfr290 T A 7: 84,916,418 I213N possibly damaging Het
Olfr50 T A 2: 36,793,265 S10T probably benign Het
Olfr63 A T 17: 33,268,884 E53D probably benign Het
Olfr904 A T 9: 38,464,727 K229* probably null Het
Oxct1 T A 15: 4,142,850 V466D probably damaging Het
Piezo2 T A 18: 63,011,721 I2768F probably damaging Het
Pitpnm1 C A 19: 4,103,319 D158E possibly damaging Het
Plekho2 T C 9: 65,556,736 N277S probably benign Het
Rab33b T C 3: 51,493,416 Y104H probably damaging Het
Rpap1 T C 2: 119,773,850 S473G probably benign Het
Serpina1b T A 12: 103,728,435 probably null Het
Slc25a17 A T 15: 81,329,176 probably null Het
Slc43a2 T C 11: 75,545,807 C160R probably damaging Het
Slc7a4 G T 16: 17,575,684 L84M possibly damaging Het
Sowahc GGGAGGAGGAGGAGGAGGAGGAGGAGGA GGGAGGAGGAGGAGGAGGAGGAGGA 10: 59,223,491 probably benign Het
Specc1 T C 11: 62,117,967 I183T probably damaging Het
Sucla2 A G 14: 73,591,129 K362E probably benign Het
Tcf12 A T 9: 71,885,302 probably null Het
Tlr11 C T 14: 50,361,201 P215S probably benign Het
Tmem41b A G 7: 109,974,865 S198P probably damaging Het
Tubgcp3 A G 8: 12,648,670 F427S probably damaging Het
Wdr81 T A 11: 75,444,748 S1752C probably damaging Het
Zbtb7a A G 10: 81,145,049 Y359C probably damaging Het
Zfp37 T C 4: 62,191,765 Y354C probably damaging Het
Zmpste24 T A 4: 121,082,877 I191F possibly damaging Het
Other mutations in Slco1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Slco1a4 APN 6 141807182 critical splice acceptor site probably null
IGL01573:Slco1a4 APN 6 141812851 splice site probably benign
IGL01735:Slco1a4 APN 6 141817751 missense probably benign 0.00
IGL03115:Slco1a4 APN 6 141819603 missense probably benign 0.05
IGL03115:Slco1a4 APN 6 141817859 missense probably damaging 1.00
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0062:Slco1a4 UTSW 6 141819479 nonsense probably null
R0305:Slco1a4 UTSW 6 141817753 missense possibly damaging 0.47
R0511:Slco1a4 UTSW 6 141830860 splice site probably benign
R0660:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R0664:Slco1a4 UTSW 6 141812741 missense probably benign 0.05
R1589:Slco1a4 UTSW 6 141845447 missense probably benign
R1606:Slco1a4 UTSW 6 141839611 missense probably damaging 1.00
R1665:Slco1a4 UTSW 6 141839577 missense possibly damaging 0.79
R1742:Slco1a4 UTSW 6 141825045 missense probably benign 0.07
R1763:Slco1a4 UTSW 6 141812731 missense probably benign 0.26
R1893:Slco1a4 UTSW 6 141834616 splice site probably null
R1908:Slco1a4 UTSW 6 141815447 critical splice donor site probably null
R1944:Slco1a4 UTSW 6 141839550 missense probably benign 0.00
R2144:Slco1a4 UTSW 6 141809378 missense probably damaging 1.00
R2276:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.49
R2340:Slco1a4 UTSW 6 141841377 missense probably benign 0.00
R3017:Slco1a4 UTSW 6 141812670 splice site probably null
R3769:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R4577:Slco1a4 UTSW 6 141819540 missense probably damaging 0.97
R4650:Slco1a4 UTSW 6 141812698 missense possibly damaging 0.94
R4801:Slco1a4 UTSW 6 141845497 start gained probably benign
R4802:Slco1a4 UTSW 6 141845497 start gained probably benign
R4896:Slco1a4 UTSW 6 141815505 missense possibly damaging 0.91
R5126:Slco1a4 UTSW 6 141815582 missense possibly damaging 0.94
R5183:Slco1a4 UTSW 6 141839631 missense probably damaging 1.00
R5399:Slco1a4 UTSW 6 141830707 missense probably damaging 0.98
R5645:Slco1a4 UTSW 6 141834659 missense possibly damaging 0.95
R5832:Slco1a4 UTSW 6 141819544 missense probably benign 0.00
R6180:Slco1a4 UTSW 6 141817820 missense possibly damaging 0.95
R6415:Slco1a4 UTSW 6 141834689 nonsense probably null
R6992:Slco1a4 UTSW 6 141819604 missense probably benign 0.05
R7024:Slco1a4 UTSW 6 141834708 missense probably benign 0.00
R7696:Slco1a4 UTSW 6 141810511 nonsense probably null
R7751:Slco1a4 UTSW 6 141834687 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGGACCATCCATCATCCATGC -3'
(R):5'- GGTTATGTTAGGTAGACACAGAAAACC -3'

Sequencing Primer
(F):5'- TCCATGCCCATTCTGAAAAATC -3'
(R):5'- GACACTCTTCTCATGTTGTACATAG -3'
Posted On2016-11-08