Mutagenetix > Incidental Mutation

Incidental Mutation 'R0079:Ahrr'

44202

Institutional Source

Beutler Lab

Gene Symbol

Ahrr

Ensembl Gene

ENSMUSG00000021575

Gene Name

aryl-hydrocarbon receptor repressor

Synonyms

MMRRC Submission

038366-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74211118-74292331 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 74283024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022059] [ENSMUST00000109640]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000022059

SMART Domains

Protein: ENSMUSP00000022059
Gene: ENSMUSG00000021575

Domain	Start	End	E-Value	Type
HLH	32	86	1.1e-11	SMART
PAS	108	174	6.6e-14	SMART
low complexity region	236	250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109640

SMART Domains

Protein: ENSMUSP00000105268
Gene: ENSMUSG00000021575

Domain	Start	End	E-Value	Type
Blast:PAS	1	46	1e-27	BLAST
PDB:4M4X\|B	1	142	2e-30	PDB
SCOP:d1jnua_	2	63	7e-3	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.4%
20x: 90.7%

Validation Efficiency

78% (155/199)

MGI Phenotype

FUNCTION: This gene encodes a protein that represses aryl hydrocarbon receptor-dependent signaling. The encoded protein competes with the aryl hydrocarbon receptor transcription factor for heterodimerization with the aryl hydrocarbon receptor nuclear translocator protein and binding to xenobiotic response element (XRE) sequence in many genes. This protein is implicated in the regulation of cell growth and differentiation as well as mediating dioxin toxicity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004P03Rik	T	A	12: 17,007,182	T105S	possibly damaging	Het
Abca13	G	A	11: 9,293,493	M1785I	probably benign	Het
Adamts3	G	C	5: 89,693,053	P804A	probably benign	Het
Ank2	G	T	3: 126,934,615	D776E	probably benign	Het
Cep152	T	A	2: 125,618,453	K193M	possibly damaging	Het
Cep55	C	T	19: 38,060,321	L142F	probably benign	Het
Chd5	A	G	4: 152,385,749	Y1884C	probably damaging	Het
Clasp1	T	C	1: 118,543,304	L890P	probably damaging	Het
Cul9	C	A	17: 46,537,663	E716*	probably null	Het
Cytip	T	A	2: 58,159,994	D21V	probably benign	Het
Denr	T	G	5: 123,924,845	F137C	probably damaging	Het
Dhrs3	A	T	4: 144,920,048	S197C	probably damaging	Het
Egr4	A	T	6: 85,512,769	M103K	probably damaging	Het
Eif4enif1	C	T	11: 3,242,676	Q835*	probably null	Het
Gckr	A	G	5: 31,306,539	I268V	probably benign	Het
Glt6d1	C	A	2: 25,794,727		probably null	Het
Hpd	T	C	5: 123,181,481	Y8C	probably damaging	Het
Il12rb2	A	T	6: 67,361,905	F16I	probably benign	Het
Ildr2	A	T	1: 166,307,720	Y347F	probably damaging	Het
Kcnv1	T	C	15: 45,113,333	D186G	probably damaging	Het
Khdrbs2	A	G	1: 32,519,915		probably null	Het
L1cam	G	T	X: 73,869,758	P16H	probably damaging	Het
Lyn	A	G	4: 3,746,768	H161R	probably damaging	Het
Mctp2	T	A	7: 72,214,116		probably benign	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mitf	A	C	6: 97,996,440	M220L	probably benign	Het
Mrpl21	T	C	19: 3,284,807	Y50H	possibly damaging	Het
Myh1	T	A	11: 67,213,411	L968Q	probably damaging	Het
Myo3b	A	G	2: 70,095,158	K18E	possibly damaging	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Nlrp2	T	A	7: 5,327,730	T556S	possibly damaging	Het
Nsmf	T	C	2: 25,059,084		probably benign	Het
Nsun7	C	T	5: 66,295,513	P558S	probably benign	Het
Olfr1168	A	T	2: 88,185,354	Y159F	possibly damaging	Het
Olfr1564	G	A	17: 33,216,105	R80C	probably benign	Het
Olfr394	T	G	11: 73,887,737	I212L	probably benign	Het
Olfr679	T	C	7: 105,085,928	S71P	probably damaging	Het
Papd5	T	A	8: 88,200,003	Y14N	possibly damaging	Het
Phf19	T	C	2: 34,895,954	N501S	probably benign	Het
Ranbp17	A	C	11: 33,500,682	I85S	probably damaging	Het
Robo1	A	G	16: 72,933,342		probably benign	Het
Sntg1	A	G	1: 8,679,062		probably benign	Het
Snx15	A	G	19: 6,123,913	L58P	probably damaging	Het
Spink5	G	T	18: 43,977,764	C134F	probably damaging	Het
Strip2	T	C	6: 29,920,533		probably null	Het
Taf1d	C	T	9: 15,309,944	A182V	probably benign	Het
Tenm3	A	G	8: 48,343,345	V475A	possibly damaging	Het
Tgds	A	T	14: 118,116,235	H223Q	possibly damaging	Het
Thoc2	G	T	X: 41,864,108	S230Y	probably benign	Het
Tm9sf4	T	A	2: 153,191,145	V290E	probably damaging	Het
Trak2	A	T	1: 58,926,724	L97Q	probably damaging	Het
Trnau1ap	A	G	4: 132,314,345	Y145H	probably damaging	Het
Vars2	A	T	17: 35,659,156	D780E	probably damaging	Het
Vmn1r170	T	A	7: 23,606,310	S46T	possibly damaging	Het
Vmn1r20	A	T	6: 57,431,792	R34S	possibly damaging	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Wdr64	T	C	1: 175,795,102	M805T	probably benign	Het
Xdh	G	A	17: 73,891,218	R1225C	probably damaging	Het
Zfp341	T	A	2: 154,624,994	Y94*	probably null	Het
Zfp641	T	C	15: 98,289,089	N218D	probably benign	Het
Zscan22	T	C	7: 12,904,087		probably null	Het

Other mutations in Ahrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02116:Ahrr	APN	13	74220573	missense	possibly damaging	0.52
IGL03143:Ahrr	APN	13	74257495	nonsense	probably null
calico_jack	UTSW	13	74222912	missense	possibly damaging	0.51
piracy	UTSW	13	74283024	splice site	probably benign
R0009:Ahrr	UTSW	13	74283024	splice site	probably benign
R0010:Ahrr	UTSW	13	74283024	splice site	probably benign
R0010:Ahrr	UTSW	13	74283024	splice site	probably benign
R0040:Ahrr	UTSW	13	74283024	splice site	probably benign
R0082:Ahrr	UTSW	13	74283024	splice site	probably benign
R0164:Ahrr	UTSW	13	74283024	splice site	probably benign
R0165:Ahrr	UTSW	13	74283024	splice site	probably benign
R0167:Ahrr	UTSW	13	74283024	splice site	probably benign
R0310:Ahrr	UTSW	13	74283024	splice site	probably benign
R0344:Ahrr	UTSW	13	74214586	missense	probably damaging	1.00
R0948:Ahrr	UTSW	13	74213769	missense	probably damaging	1.00
R1192:Ahrr	UTSW	13	74214403	missense	probably benign	0.00
R1438:Ahrr	UTSW	13	74224868	nonsense	probably null
R1532:Ahrr	UTSW	13	74213707	missense	probably benign	0.01
R1600:Ahrr	UTSW	13	74214378	missense	probably benign	0.00
R2302:Ahrr	UTSW	13	74277661	missense	probably damaging	1.00
R3055:Ahrr	UTSW	13	74224887	missense	probably damaging	1.00
R4683:Ahrr	UTSW	13	74224766	splice site	silent
R4717:Ahrr	UTSW	13	74215766	missense	probably benign	0.03
R4769:Ahrr	UTSW	13	74214212	missense	probably damaging	1.00
R5998:Ahrr	UTSW	13	74213836	missense	probably damaging	0.99
R6225:Ahrr	UTSW	13	74222912	missense	possibly damaging	0.51
R7156:Ahrr	UTSW	13	74229916	missense	probably damaging	1.00
R7424:Ahrr	UTSW	13	74257545	nonsense	probably null
R8441:Ahrr	UTSW	13	74214063	missense	probably benign	0.03
R8502:Ahrr	UTSW	13	74283074	missense	probably damaging	1.00
R8534:Ahrr	UTSW	13	74220680	missense	probably damaging	1.00
Z1177:Ahrr	UTSW	13	74224776	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGGCACTTTCCACAGACAGAATGAC -3'
(R):5'- TGAGGGCCAATGGATCGTACTGAC -3'

Sequencing Primer
(F):5'- CCACAGACAGAATGACTTATTGCTG -3'
(R):5'- AATGGATCGTACTGACCTTCTTG -3'

Posted On

2013-06-11