Incidental Mutation 'R5657:Sun2'
ID442399
Institutional Source Beutler Lab
Gene Symbol Sun2
Ensembl Gene ENSMUSG00000042524
Gene NameSad1 and UNC84 domain containing 2
SynonymsUnc84b, B230369L08Rik
MMRRC Submission 043171-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5657 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location79724070-79742536 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 79727949 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 510 (E510*)
Ref Sequence ENSEMBL: ENSMUSP00000098006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046259] [ENSMUST00000089311] [ENSMUST00000100439]
Predicted Effect probably null
Transcript: ENSMUST00000046259
AA Change: E512*
SMART Domains Protein: ENSMUSP00000047864
Gene: ENSMUSG00000042524
AA Change: E512*

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
low complexity region 327 339 N/A INTRINSIC
coiled coil region 418 453 N/A INTRINSIC
coiled coil region 491 519 N/A INTRINSIC
Pfam:Sad1_UNC 595 729 1.3e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089311
AA Change: E480*
SMART Domains Protein: ENSMUSP00000086724
Gene: ENSMUSG00000042524
AA Change: E480*

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
coiled coil region 386 421 N/A INTRINSIC
coiled coil region 459 487 N/A INTRINSIC
Pfam:Sad1_UNC 563 697 1.1e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000100439
AA Change: E510*
SMART Domains Protein: ENSMUSP00000098006
Gene: ENSMUSG00000042524
AA Change: E510*

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 63 80 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
low complexity region 325 337 N/A INTRINSIC
coiled coil region 416 451 N/A INTRINSIC
coiled coil region 489 517 N/A INTRINSIC
Pfam:Sad1_UNC 593 727 1.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231189
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SUN1 (MIM 607723) and SUN2 are inner nuclear membrane (INM) proteins that play a major role in nuclear-cytoplasmic connection by formation of a 'bridge' across the nuclear envelope, known as the LINC complex, via interaction with the conserved luminal KASH domain of nesprins (e.g., SYNE1; MIM 608441) located in the outer nuclear membrane (ONM). The LINC complex provides a direct connection between the nuclear lamina and the cytoskeleton, which contributes to nuclear positioning and cellular rigidity (summary by Haque et al., 2010 [PubMed 19933576]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A G 5: 30,894,046 Y533C probably damaging Het
Ahnak T C 19: 9,014,615 V4421A probably damaging Het
Bach1 A G 16: 87,719,285 K238R probably benign Het
Bloc1s6 T A 2: 122,738,657 V12D probably benign Het
Clca3b C A 3: 144,827,383 L629F probably benign Het
Clhc1 A G 11: 29,561,431 I292V probably benign Het
Col27a1 T C 4: 63,225,310 S412P probably damaging Het
Col6a4 A G 9: 106,072,198 I746T probably damaging Het
Cracr2a G A 6: 127,604,007 A49T probably damaging Het
Cyb561d1 A G 3: 108,200,692 I28T possibly damaging Het
Dnah11 T A 12: 117,883,617 M4264L probably damaging Het
Dnajc13 A G 9: 104,228,537 L412S probably damaging Het
Dpf3 T C 12: 83,325,011 N150S probably damaging Het
Epha2 T C 4: 141,323,494 C854R probably damaging Het
Fat2 G T 11: 55,310,681 Y522* probably null Het
Foxm1 A T 6: 128,373,388 S551C possibly damaging Het
Galnt12 T C 4: 47,104,150 V136A possibly damaging Het
Gm6647 T G 5: 13,768,821 noncoding transcript Het
Grin2b T A 6: 135,733,087 I1154F possibly damaging Het
Hmcn1 A G 1: 150,658,562 V2987A probably benign Het
Jade2 A G 11: 51,816,987 S800P probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr393 T C 11: 73,847,540 N195S probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plod1 T C 4: 147,918,781 E529G possibly damaging Het
Plppr2 T C 9: 21,947,615 C343R probably damaging Het
Prpf38a T C 4: 108,568,424 D219G probably damaging Het
Ptpra G A 2: 130,504,284 E122K probably benign Het
Rabl2 T C 15: 89,588,213 M38V probably benign Het
Reep1 A G 6: 71,761,374 M39V possibly damaging Het
Rsf1 GC GCGGCGGCGTC 7: 97,579,934 probably benign Het
Slc26a10 T C 10: 127,174,964 probably benign Het
Tanc1 A G 2: 59,834,707 probably null Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Tor1aip1 G T 1: 156,007,488 H205N probably damaging Het
Trpc6 C T 9: 8,609,807 T92I probably benign Het
Vmn2r100 T A 17: 19,504,916 F36I probably benign Het
Zfp787 T C 7: 6,133,054 Y66C probably damaging Het
Other mutations in Sun2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03325:Sun2 APN 15 79738648 missense probably benign 0.34
R0049:Sun2 UTSW 15 79727609 splice site probably benign
R0049:Sun2 UTSW 15 79727609 splice site probably benign
R0189:Sun2 UTSW 15 79737076 missense probably damaging 1.00
R0349:Sun2 UTSW 15 79730232 missense probably damaging 1.00
R1183:Sun2 UTSW 15 79728468 missense probably damaging 1.00
R1751:Sun2 UTSW 15 79725557 missense probably benign
R1767:Sun2 UTSW 15 79725557 missense probably benign
R1843:Sun2 UTSW 15 79737563 missense probably benign
R2005:Sun2 UTSW 15 79726624 missense possibly damaging 0.80
R2062:Sun2 UTSW 15 79738651 missense probably damaging 1.00
R2358:Sun2 UTSW 15 79727913 missense possibly damaging 0.95
R3712:Sun2 UTSW 15 79727913 missense possibly damaging 0.95
R3937:Sun2 UTSW 15 79734155 missense probably benign 0.14
R3938:Sun2 UTSW 15 79734155 missense probably benign 0.14
R4869:Sun2 UTSW 15 79728386 intron probably benign
R4871:Sun2 UTSW 15 79727564 missense probably damaging 1.00
R5375:Sun2 UTSW 15 79727522 missense probably damaging 1.00
R5482:Sun2 UTSW 15 79737511 missense probably benign 0.01
R5555:Sun2 UTSW 15 79734127 missense probably benign 0.01
R5662:Sun2 UTSW 15 79738868 missense probably benign 0.01
R6144:Sun2 UTSW 15 79730332 missense probably benign
R6975:Sun2 UTSW 15 79734219 nonsense probably null
R7127:Sun2 UTSW 15 79727899 missense probably benign 0.00
R7358:Sun2 UTSW 15 79734112 missense probably benign 0.29
R7614:Sun2 UTSW 15 79739024 splice site probably null
R8181:Sun2 UTSW 15 79725520 missense probably damaging 0.99
R8343:Sun2 UTSW 15 79738924 missense probably damaging 1.00
Z1177:Sun2 UTSW 15 79738520 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGCCCAGAATCTACACCTG -3'
(R):5'- ATAGCTGCCCCTGCCATTAG -3'

Sequencing Primer
(F):5'- CAGGAGGGTCTATCATGTCCTAAC -3'
(R):5'- CCATTAGTGCAAGCTTCTGAGTGAC -3'
Posted On2016-11-09