Incidental Mutation 'R5784:Wdr27'
ID447937
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene NameWD repeat domain 27
Synonyms0610012K18Rik
MMRRC Submission 043381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5784 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14818519-14943158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14926233 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 167 (T167S)
Ref Sequence ENSEMBL: ENSMUSP00000155992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
Predicted Effect probably damaging
Transcript: ENSMUST00000170386
AA Change: T167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: T167S

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228330
AA Change: T167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000232147
AA Change: T167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7571 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,607 R292G possibly damaging Het
4932416K20Rik T A 8: 104,797,629 noncoding transcript Het
Aox3 A G 1: 58,153,499 D544G probably benign Het
Atg2a C A 19: 6,261,505 A1830D probably damaging Het
Casp1 T C 9: 5,299,337 I22T probably damaging Het
Ccdc141 A C 2: 77,029,327 L990W probably damaging Het
Cnbd2 A G 2: 156,338,657 T125A probably damaging Het
Cnep1r1 T A 8: 88,130,726 probably benign Het
Dhx38 G T 8: 109,559,613 Y348* probably null Het
Dnah7c A T 1: 46,524,068 I593L possibly damaging Het
Dpep3 T C 8: 105,978,743 D125G probably benign Het
Epb41l4b A C 4: 57,086,003 S191A probably damaging Het
Etl4 A G 2: 20,806,205 Y1033C possibly damaging Het
Fam193a T C 5: 34,466,223 L32P probably damaging Het
Gm8332 T A 12: 88,249,755 N116Y probably damaging Het
Grin2c T C 11: 115,258,295 E159G possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdhd2 A T 18: 76,967,145 D205V probably damaging Het
Helz T A 11: 107,670,481 N774K unknown Het
Idh3b A G 2: 130,279,671 V71A probably damaging Het
Lars T C 18: 42,219,899 M818V probably benign Het
Ltbp2 A G 12: 84,868,739 V162A probably damaging Het
Ltk G A 2: 119,754,359 Q136* probably null Het
Mafb A T 2: 160,366,541 C46S probably damaging Het
Map1s T C 8: 70,914,358 S636P probably damaging Het
Map3k13 A G 16: 21,898,641 K209E possibly damaging Het
Mppe1 T C 18: 67,228,027 N220D probably benign Het
Mydgf T C 17: 56,178,254 probably benign Het
Myh6 T C 14: 54,953,064 K999E possibly damaging Het
Nemp1 T A 10: 127,677,198 V34D possibly damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Olfr1497 A T 19: 13,795,346 H88Q probably benign Het
Olfr248 G A 1: 174,391,399 C110Y probably damaging Het
Olfr309 T C 7: 86,306,535 N193D probably damaging Het
Papln A G 12: 83,781,980 N820S probably benign Het
Pcdh10 T G 3: 45,380,640 F463C probably damaging Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Radil G T 5: 142,487,513 H804Q possibly damaging Het
Rbfox1 A T 16: 7,224,339 D39V probably damaging Het
Rims2 T G 15: 39,535,987 probably null Het
Rnf121 A G 7: 102,035,376 F110S probably benign Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc2a3 A T 6: 122,735,417 probably null Het
Traf2 A T 2: 25,539,037 V6E probably benign Het
Trim43c A T 9: 88,847,643 N379I probably benign Het
Ubr4 C G 4: 139,425,218 C1973W probably damaging Het
Unc13a G T 8: 71,655,666 D514E possibly damaging Het
Zfp174 A T 16: 3,854,574 E329V probably benign Het
Zfp422 A T 6: 116,626,810 I76N probably damaging Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 14928310 nonsense probably null
IGL00973:Wdr27 APN 17 14913878 missense probably benign 0.01
IGL01012:Wdr27 APN 17 14926247 missense probably damaging 1.00
IGL01924:Wdr27 APN 17 14917226 missense probably damaging 0.99
IGL02044:Wdr27 APN 17 14901769 missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 14908598 missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 14901800 missense probably damaging 0.98
IGL02496:Wdr27 APN 17 14892431 splice site probably benign
IGL02552:Wdr27 APN 17 14926191 missense probably damaging 1.00
IGL02590:Wdr27 APN 17 14917779 missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 14876176 missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 14910110 splice site probably benign
IGL03295:Wdr27 APN 17 14934575 missense possibly damaging 0.71
PIT4498001:Wdr27 UTSW 17 14934569 missense probably benign 0.01
R0329:Wdr27 UTSW 17 14934459 splice site probably benign
R0671:Wdr27 UTSW 17 14928396 missense probably benign 0.04
R1166:Wdr27 UTSW 17 14892471 missense probably damaging 1.00
R1308:Wdr27 UTSW 17 14928384 missense probably damaging 0.98
R1652:Wdr27 UTSW 17 14917270 missense probably benign 0.01
R1771:Wdr27 UTSW 17 14892441 missense probably damaging 1.00
R1966:Wdr27 UTSW 17 14934599 missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 14920854 missense probably benign 0.44
R2131:Wdr27 UTSW 17 14928332 missense probably damaging 1.00
R3803:Wdr27 UTSW 17 14918109 missense probably benign 0.01
R4335:Wdr27 UTSW 17 14920756 splice site probably null
R4577:Wdr27 UTSW 17 14903462 missense probably benign 0.00
R4787:Wdr27 UTSW 17 14932554 missense possibly damaging 0.86
R4853:Wdr27 UTSW 17 14917213 splice site probably null
R4922:Wdr27 UTSW 17 14920754 splice site probably null
R4951:Wdr27 UTSW 17 14876133 missense probably damaging 0.99
R5809:Wdr27 UTSW 17 14883669 missense probably damaging 1.00
R6128:Wdr27 UTSW 17 14932534 nonsense probably null
R6584:Wdr27 UTSW 17 14901769 missense probably damaging 1.00
R6705:Wdr27 UTSW 17 14934590 missense probably damaging 1.00
R7511:Wdr27 UTSW 17 14883703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTCGGGTGCATGCTTT -3'
(R):5'- AGAGTTATGTATGTTTGTGCACATAT -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CATGTGAGTCCCAGTGTCTGAAC -3'
Posted On2016-12-15