Incidental Mutation 'R5784:Pcdh10'
ID447905
Institutional Source Beutler Lab
Gene Symbol Pcdh10
Ensembl Gene ENSMUSG00000049100
Gene Nameprotocadherin 10
Synonyms6430521D13Rik, OL-pc, 6430703F07Rik
MMRRC Submission 043381-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R5784 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location45378398-45435623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45380640 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 463 (F463C)
Ref Sequence ENSEMBL: ENSMUSP00000131600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166126] [ENSMUST00000170695] [ENSMUST00000171554] [ENSMUST00000193252]
Predicted Effect probably damaging
Transcript: ENSMUST00000166126
AA Change: F463C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131073
Gene: ENSMUSG00000049100
AA Change: F463C

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
Pfam:Cadherin_C_2 713 838 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170695
AA Change: F463C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132769
Gene: ENSMUSG00000049100
AA Change: F463C

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171554
AA Change: F463C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131600
Gene: ENSMUSG00000049100
AA Change: F463C

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191843
Predicted Effect probably damaging
Transcript: ENSMUST00000193252
AA Change: F463C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141529
Gene: ENSMUSG00000049100
AA Change: F463C

DomainStartEndE-ValueType
CA 34 120 1.64e-2 SMART
CA 144 248 1.46e-12 SMART
CA 272 356 2.88e-25 SMART
CA 380 461 1.9e-25 SMART
CA 485 572 1.8e-26 SMART
CA 603 686 8.29e-17 SMART
low complexity region 687 697 N/A INTRINSIC
transmembrane domain 716 738 N/A INTRINSIC
low complexity region 751 772 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195655
Meta Mutation Damage Score 0.9587 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This family member contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein is a cadherin-related neuronal receptor thought to function in the establishment of specific cell-cell connections in the brain. This gene plays a role in inhibiting cancer cell motility and cell migration. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele die within several weeks of birth and exhibit decreased body size and defective striatal axon growth and thalamocortical projections in the ventral telencephalon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,607 R292G possibly damaging Het
4932416K20Rik T A 8: 104,797,629 noncoding transcript Het
Aox3 A G 1: 58,153,499 D544G probably benign Het
Atg2a C A 19: 6,261,505 A1830D probably damaging Het
Casp1 T C 9: 5,299,337 I22T probably damaging Het
Ccdc141 A C 2: 77,029,327 L990W probably damaging Het
Cnbd2 A G 2: 156,338,657 T125A probably damaging Het
Cnep1r1 T A 8: 88,130,726 probably benign Het
Dhx38 G T 8: 109,559,613 Y348* probably null Het
Dnah7c A T 1: 46,524,068 I593L possibly damaging Het
Dpep3 T C 8: 105,978,743 D125G probably benign Het
Epb41l4b A C 4: 57,086,003 S191A probably damaging Het
Etl4 A G 2: 20,806,205 Y1033C possibly damaging Het
Fam193a T C 5: 34,466,223 L32P probably damaging Het
Gm8332 T A 12: 88,249,755 N116Y probably damaging Het
Grin2c T C 11: 115,258,295 E159G possibly damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hdhd2 A T 18: 76,967,145 D205V probably damaging Het
Helz T A 11: 107,670,481 N774K unknown Het
Idh3b A G 2: 130,279,671 V71A probably damaging Het
Lars T C 18: 42,219,899 M818V probably benign Het
Ltbp2 A G 12: 84,868,739 V162A probably damaging Het
Ltk G A 2: 119,754,359 Q136* probably null Het
Mafb A T 2: 160,366,541 C46S probably damaging Het
Map1s T C 8: 70,914,358 S636P probably damaging Het
Map3k13 A G 16: 21,898,641 K209E possibly damaging Het
Mppe1 T C 18: 67,228,027 N220D probably benign Het
Mydgf T C 17: 56,178,254 probably benign Het
Myh6 T C 14: 54,953,064 K999E possibly damaging Het
Nemp1 T A 10: 127,677,198 V34D possibly damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Olfr1497 A T 19: 13,795,346 H88Q probably benign Het
Olfr248 G A 1: 174,391,399 C110Y probably damaging Het
Olfr309 T C 7: 86,306,535 N193D probably damaging Het
Papln A G 12: 83,781,980 N820S probably benign Het
Pde7a A G 3: 19,264,845 V12A probably benign Het
Radil G T 5: 142,487,513 H804Q possibly damaging Het
Rbfox1 A T 16: 7,224,339 D39V probably damaging Het
Rims2 T G 15: 39,535,987 probably null Het
Rnf121 A G 7: 102,035,376 F110S probably benign Het
Saxo2 C T 7: 82,634,874 V259I probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc2a3 A T 6: 122,735,417 probably null Het
Traf2 A T 2: 25,539,037 V6E probably benign Het
Trim43c A T 9: 88,847,643 N379I probably benign Het
Ubr4 C G 4: 139,425,218 C1973W probably damaging Het
Unc13a G T 8: 71,655,666 D514E possibly damaging Het
Wdr27 T A 17: 14,926,233 T167S probably damaging Het
Zfp174 A T 16: 3,854,574 E329V probably benign Het
Zfp422 A T 6: 116,626,810 I76N probably damaging Het
Other mutations in Pcdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Pcdh10 APN 3 45380302 missense probably damaging 1.00
IGL01115:Pcdh10 APN 3 45392775 missense probably damaging 1.00
IGL01535:Pcdh10 APN 3 45379643 missense probably damaging 1.00
IGL01600:Pcdh10 APN 3 45379487 missense probably damaging 0.98
IGL01625:Pcdh10 APN 3 45379397 missense probably damaging 0.99
IGL01966:Pcdh10 APN 3 45380298 missense probably benign 0.05
IGL02232:Pcdh10 APN 3 45380942 missense probably benign 0.00
IGL02490:Pcdh10 APN 3 45380487 missense probably damaging 1.00
IGL02890:Pcdh10 APN 3 45392617 missense probably damaging 1.00
IGL02976:Pcdh10 APN 3 45380013 missense possibly damaging 0.92
IGL02997:Pcdh10 APN 3 45379362 missense probably damaging 1.00
IGL03006:Pcdh10 APN 3 45379502 missense probably damaging 0.99
IGL03385:Pcdh10 APN 3 45381512 missense possibly damaging 0.77
R0025:Pcdh10 UTSW 3 45380499 missense possibly damaging 0.93
R0157:Pcdh10 UTSW 3 45379701 missense probably damaging 1.00
R0372:Pcdh10 UTSW 3 45379497 missense probably damaging 1.00
R0652:Pcdh10 UTSW 3 45379764 missense probably damaging 1.00
R0760:Pcdh10 UTSW 3 45380570 missense probably benign 0.19
R0976:Pcdh10 UTSW 3 45380801 missense probably damaging 1.00
R1307:Pcdh10 UTSW 3 45381879 missense probably benign 0.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1466:Pcdh10 UTSW 3 45379974 missense probably damaging 1.00
R1510:Pcdh10 UTSW 3 45379403 missense probably damaging 1.00
R1619:Pcdh10 UTSW 3 45380312 missense possibly damaging 0.94
R1678:Pcdh10 UTSW 3 45381881 nonsense probably null
R1687:Pcdh10 UTSW 3 45380015 missense probably damaging 1.00
R1750:Pcdh10 UTSW 3 45381881 nonsense probably null
R1751:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1767:Pcdh10 UTSW 3 45384177 missense probably damaging 1.00
R1857:Pcdh10 UTSW 3 45379937 missense possibly damaging 0.86
R2086:Pcdh10 UTSW 3 45380471 missense probably damaging 0.98
R3960:Pcdh10 UTSW 3 45379314 missense probably benign
R4083:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4084:Pcdh10 UTSW 3 45392707 missense probably damaging 1.00
R4112:Pcdh10 UTSW 3 45381620 missense probably damaging 1.00
R4754:Pcdh10 UTSW 3 45380637 missense probably damaging 0.99
R4946:Pcdh10 UTSW 3 45379482 missense probably damaging 1.00
R5039:Pcdh10 UTSW 3 45381861 missense probably damaging 1.00
R5224:Pcdh10 UTSW 3 45392814 missense probably damaging 0.99
R5233:Pcdh10 UTSW 3 45384191 missense probably damaging 1.00
R5261:Pcdh10 UTSW 3 45381812 missense probably damaging 1.00
R5429:Pcdh10 UTSW 3 45384200 missense probably benign 0.00
R5488:Pcdh10 UTSW 3 45381368 missense probably damaging 1.00
R5558:Pcdh10 UTSW 3 45384168 missense probably damaging 1.00
R5815:Pcdh10 UTSW 3 45392721 missense probably benign 0.04
R6283:Pcdh10 UTSW 3 45381554 missense possibly damaging 0.46
R6396:Pcdh10 UTSW 3 45380060 missense possibly damaging 0.46
R6703:Pcdh10 UTSW 3 45381299 missense possibly damaging 0.87
R6756:Pcdh10 UTSW 3 45380106 missense possibly damaging 0.80
R6968:Pcdh10 UTSW 3 45379542 missense probably damaging 1.00
R7463:Pcdh10 UTSW 3 45383572 missense possibly damaging 0.59
R7574:Pcdh10 UTSW 3 45381375 missense possibly damaging 0.92
R7691:Pcdh10 UTSW 3 45381197 missense probably damaging 1.00
R7795:Pcdh10 UTSW 3 45380222 missense probably benign 0.09
R8057:Pcdh10 UTSW 3 45379259 missense probably benign 0.00
R8082:Pcdh10 UTSW 3 45381744 missense probably damaging 1.00
R8302:Pcdh10 UTSW 3 45381498 missense probably damaging 0.99
X0013:Pcdh10 UTSW 3 45379566 missense probably damaging 1.00
Z1177:Pcdh10 UTSW 3 45381729 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTGTGAGCTTCTGGGAGAC -3'
(R):5'- ATAGTCGAAGGATCTCAGGGC -3'

Sequencing Primer
(F):5'- TCTGGGAGACGTGCCGTTC -3'
(R):5'- ATCTCAGGGCGTACAAGTAGCC -3'
Posted On2016-12-15