Incidental Mutation 'R5834:Ednrb'
ID 449497
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETb, ETR-b, Sox10m1
MMRRC Submission 044055-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock # R5834 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 103814625-103844402 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103820877 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 330 (L330P)
Ref Sequence ENSEMBL: ENSMUSP00000154806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
AlphaFold P48302
Predicted Effect probably damaging
Transcript: ENSMUST00000022718
AA Change: L330P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: L330P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172237
AA Change: L330P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: L330P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227824
AA Change: L330P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G A 8: 105,282,123 Q421* probably null Het
Abca13 T C 11: 9,277,974 probably null Het
Adamts20 A C 15: 94,353,584 S441A probably damaging Het
Aen T A 7: 78,907,301 M299K probably damaging Het
Akap3 T C 6: 126,865,833 S472P probably benign Het
Ank3 T G 10: 69,822,257 V158G probably damaging Het
Arfgap1 A G 2: 180,981,162 D324G probably benign Het
Aste1 A T 9: 105,403,415 R448S probably benign Het
Atp10a T A 7: 58,658,618 L55Q probably benign Het
C1qtnf9 G A 14: 60,779,450 G143D probably damaging Het
Camsap2 A G 1: 136,280,388 V1122A probably benign Het
Cbl T C 9: 44,233,779 H37R probably damaging Het
Cfap61 A C 2: 146,129,149 D893A probably benign Het
Chd2 T A 7: 73,478,715 I841F probably damaging Het
Chd9 A G 8: 90,997,164 T622A probably damaging Het
Cntnap3 A G 13: 64,748,577 Y1028H probably benign Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp2c55 A G 19: 39,042,067 I448V probably benign Het
Cyth1 T A 11: 118,192,463 probably null Het
Dcaf13 C T 15: 39,143,642 R324* probably null Het
Dhx37 C A 5: 125,425,730 R42L probably damaging Het
Dock1 T A 7: 134,763,933 V450E probably damaging Het
Eml4 T A 17: 83,477,741 H778Q probably damaging Het
Evx1 T A 6: 52,315,990 I227N probably damaging Het
G3bp1 T A 11: 55,497,940 V326E probably benign Het
Gata2 T C 6: 88,200,747 V253A probably benign Het
Gbp2 A G 3: 142,633,377 N397D probably damaging Het
Gm14401 C A 2: 177,086,903 H261N probably benign Het
Hacd4 A T 4: 88,398,152 H243Q probably benign Het
Hsd3b1 C A 3: 98,852,939 K245N possibly damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ift27 A T 15: 78,165,243 C86S probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irs3 T A 5: 137,644,559 S206C probably damaging Het
Lefty2 C T 1: 180,893,151 probably benign Het
Mark3 A G 12: 111,624,487 I162V probably damaging Het
Mefv A C 16: 3,716,046 D120E probably damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mre11a A G 9: 14,799,657 I45V probably benign Het
Mtor A G 4: 148,536,536 N1797S possibly damaging Het
Nav1 A C 1: 135,532,406 M393R probably benign Het
Nod2 T C 8: 88,664,639 S510P possibly damaging Het
Nos2 C T 11: 78,928,579 T39I probably benign Het
Olfr474 T A 7: 107,954,906 H88Q probably benign Het
Olfr93 A T 17: 37,151,799 Y58N probably damaging Het
Pcdh7 A G 5: 57,721,628 S842G possibly damaging Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Plaa A C 4: 94,583,469 V10G probably damaging Het
Pprc1 T A 19: 46,065,220 probably benign Het
Ptprt T C 2: 161,560,269 Y994C probably damaging Het
Ripply2 T A 9: 87,015,890 W37R probably damaging Het
Rpgrip1 A G 14: 52,158,382 D1227G probably damaging Het
Scoc C T 8: 83,437,631 D10N possibly damaging Het
Sdk2 A T 11: 113,854,273 I732N probably damaging Het
Six2 T C 17: 85,687,664 K97E probably damaging Het
Slit2 A C 5: 48,259,647 N1014H probably damaging Het
Smc1b A C 15: 85,089,665 L930R probably damaging Het
Spag16 T A 1: 69,923,714 M340K probably benign Het
Spata31 C T 13: 64,922,666 S876L probably benign Het
Spen A G 4: 141,471,843 Y3135H possibly damaging Het
Spta1 A T 1: 174,184,797 probably null Het
Stk3 G A 15: 34,959,018 T336I probably damaging Het
Tas2r118 T A 6: 23,969,877 T62S probably benign Het
Tmprss11d A G 5: 86,306,310 M212T probably damaging Het
Trpc7 A G 13: 56,776,158 L738P probably damaging Het
Ttll8 A G 15: 88,917,246 V413A possibly damaging Het
Usb1 G A 8: 95,333,533 probably benign Het
Vmn1r238 T C 18: 3,123,168 E82G probably benign Het
Vmn2r114 T C 17: 23,310,625 T168A possibly damaging Het
Vmn2r60 C A 7: 42,116,508 P13H probably benign Het
Wdr26 A G 1: 181,203,147 L194P probably damaging Het
Zfhx2 G A 14: 55,073,330 Q636* probably null Het
Zfyve26 A G 12: 79,266,537 Y25H probably benign Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 103820019 missense probably damaging 1.00
IGL01433:Ednrb APN 14 103843190 missense probably damaging 0.98
IGL01631:Ednrb APN 14 103843225 missense probably benign 0.02
IGL01696:Ednrb APN 14 103823189 missense probably benign 0.00
IGL01974:Ednrb APN 14 103820818 missense probably damaging 1.00
IGL02749:Ednrb APN 14 103823059 missense possibly damaging 0.63
IGL03277:Ednrb APN 14 103843299 missense probably benign 0.00
gus-gus UTSW 14 103820013 missense probably damaging 1.00
pongo UTSW 14 103823274 splice site probably null
sposh UTSW 14 103821714 missense probably damaging 0.97
R0284:Ednrb UTSW 14 103820013 missense probably damaging 1.00
R0591:Ednrb UTSW 14 103823274 splice site probably null
R2072:Ednrb UTSW 14 103817099 missense probably benign 0.27
R2080:Ednrb UTSW 14 103843100 missense probably damaging 1.00
R2102:Ednrb UTSW 14 103820914 nonsense probably null
R2118:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2119:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2124:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2851:Ednrb UTSW 14 103821674 missense probably benign 0.04
R2852:Ednrb UTSW 14 103821674 missense probably benign 0.04
R3708:Ednrb UTSW 14 103817080 missense probably damaging 1.00
R4887:Ednrb UTSW 14 103820011 missense possibly damaging 0.95
R5626:Ednrb UTSW 14 103843128 missense probably damaging 0.98
R5688:Ednrb UTSW 14 103823395 missense probably damaging 1.00
R5802:Ednrb UTSW 14 103821714 missense probably damaging 0.97
R7212:Ednrb UTSW 14 103843008 missense probably damaging 0.96
R7368:Ednrb UTSW 14 103820017 missense probably benign 0.01
R7766:Ednrb UTSW 14 103843289 missense probably benign 0.12
R7866:Ednrb UTSW 14 103843302 missense probably benign
R8170:Ednrb UTSW 14 103823204 missense possibly damaging 0.92
R8220:Ednrb UTSW 14 103821705 missense probably damaging 1.00
R8299:Ednrb UTSW 14 103823500 missense probably damaging 1.00
R8375:Ednrb UTSW 14 103819947 missense probably damaging 1.00
R8431:Ednrb UTSW 14 103843197 missense probably benign 0.00
R9035:Ednrb UTSW 14 103843229 missense probably benign 0.00
R9128:Ednrb UTSW 14 103843092 missense probably damaging 1.00
R9546:Ednrb UTSW 14 103843023 missense probably benign
R9547:Ednrb UTSW 14 103843023 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGCTGGATGACAATTCC -3'
(R):5'- AACATGAGCCACTGTGGAGG -3'

Sequencing Primer
(F):5'- CTCTTTCAATCTAAGTTAGCACAGG -3'
(R):5'- CCACTGTGGAGGTACTTGTACTAGC -3'
Posted On 2016-12-20