Incidental Mutation 'R5688:Ednrb'
ID443530
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Nameendothelin receptor type B
SynonymsETb, ETR-b, Sox10m1
MMRRC Submission 043321-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R5688 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location103814625-103844402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103823395 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 198 (D198G)
Ref Sequence ENSEMBL: ENSMUSP00000154806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
Predicted Effect probably damaging
Transcript: ENSMUST00000022718
AA Change: D198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: D198G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172237
AA Change: D198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: D198G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227824
AA Change: D198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T A 7: 34,253,991 T449S possibly damaging Het
4931406P16Rik T G 7: 34,284,709 D163A probably damaging Het
Acp7 G A 7: 28,616,495 A222V probably benign Het
Ahnak A G 19: 9,002,519 D389G probably benign Het
Aldh1l2 A T 10: 83,501,925 S559T possibly damaging Het
Alms1 T A 6: 85,599,895 N144K possibly damaging Het
Anp32b T A 4: 46,469,868 probably null Het
Atf7 C T 15: 102,551,509 R57H probably damaging Het
Atp10b A T 11: 43,201,173 H345L probably benign Het
Cacna2d1 A T 5: 16,358,952 I859F probably damaging Het
Calcr T A 6: 3,714,730 probably null Het
Cd248 A G 19: 5,069,935 T604A probably benign Het
Cemip C T 7: 83,961,641 V702M probably damaging Het
Cep295 G T 9: 15,331,986 Q469K probably damaging Het
Cntn5 A G 9: 9,748,422 W485R probably damaging Het
Cpe T C 8: 64,609,155 N289S possibly damaging Het
Cyp2j11 G A 4: 96,345,121 R113C probably damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb7 T G 8: 19,495,151 L15R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Engase A C 11: 118,487,320 E312A possibly damaging Het
Evl G A 12: 108,673,353 probably null Het
Faf1 C A 4: 109,794,813 Q234K probably damaging Het
Gm5460 C A 14: 34,045,795 N453K possibly damaging Het
Gm7356 T A 17: 14,000,607 I387F possibly damaging Het
Hagh T C 17: 24,850,594 M1T probably null Het
Hars A T 18: 36,772,316 V155E probably damaging Het
Hist1h1c A G 13: 23,739,165 K106R probably damaging Het
Lca5 C A 9: 83,398,566 D394Y probably benign Het
Lmtk3 T C 7: 45,791,410 L280P probably damaging Het
Lrit1 C T 14: 37,062,428 A571V possibly damaging Het
Map4k2 C A 19: 6,346,806 P584H probably damaging Het
Mgst1 T C 6: 138,141,800 probably benign Het
Neb C T 2: 52,196,327 V5245I probably damaging Het
Oas3 T C 5: 120,758,802 N918S probably benign Het
Olfr1155 T A 2: 87,943,208 Q140L probably benign Het
Olfr1204 C T 2: 88,852,679 T243I probably benign Het
Olfr145 A C 9: 37,898,063 I220L possibly damaging Het
Ovch2 A G 7: 107,793,994 L224P probably damaging Het
Patj A T 4: 98,520,810 K34* probably null Het
Pcf11 T A 7: 92,658,808 R717S possibly damaging Het
Plcb1 A T 2: 135,335,480 E577D probably benign Het
Plxnb2 T C 15: 89,158,696 K1497E probably damaging Het
Pyroxd1 C A 6: 142,353,540 L141I probably damaging Het
Rhobtb3 G T 13: 75,872,418 N588K probably benign Het
Rnasel G A 1: 153,753,706 probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shank1 A T 7: 44,354,487 I1868F possibly damaging Het
Skiv2l2 A T 13: 112,873,056 C936* probably null Het
Slc28a3 A T 13: 58,558,649 S593T probably damaging Het
Slc29a4 T C 5: 142,714,098 I168T possibly damaging Het
Slc35f5 C T 1: 125,591,038 P502L probably benign Het
Slco6d1 T C 1: 98,480,768 I463T probably damaging Het
Slk A G 19: 47,620,012 D468G probably benign Het
Spata31d1d G T 13: 59,726,508 P1071Q probably damaging Het
Tert G A 13: 73,639,156 V754I probably damaging Het
Thada T C 17: 84,451,727 T235A probably benign Het
Ttn T C 2: 76,734,128 D28555G probably damaging Het
Ttn T A 2: 76,879,984 probably null Het
Ubqln4 T C 3: 88,565,268 L464P probably damaging Het
Unc45b A T 11: 82,922,817 N350I possibly damaging Het
Vmn2r65 T C 7: 84,940,692 D672G probably benign Het
Zfp947 T A 17: 22,146,085 I203L probably benign Het
Zfp964 T A 8: 69,664,116 H454Q probably benign Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 103820019 missense probably damaging 1.00
IGL01433:Ednrb APN 14 103843190 missense probably damaging 0.98
IGL01631:Ednrb APN 14 103843225 missense probably benign 0.02
IGL01696:Ednrb APN 14 103823189 missense probably benign 0.00
IGL01974:Ednrb APN 14 103820818 missense probably damaging 1.00
IGL02749:Ednrb APN 14 103823059 missense possibly damaging 0.63
IGL03277:Ednrb APN 14 103843299 missense probably benign 0.00
gus-gus UTSW 14 103820013 missense probably damaging 1.00
pongo UTSW 14 103823274 splice site probably null
sposh UTSW 14 103821714 missense probably damaging 0.97
R0284:Ednrb UTSW 14 103820013 missense probably damaging 1.00
R0591:Ednrb UTSW 14 103823274 splice site probably null
R2072:Ednrb UTSW 14 103817099 missense probably benign 0.27
R2080:Ednrb UTSW 14 103843100 missense probably damaging 1.00
R2102:Ednrb UTSW 14 103820914 nonsense probably null
R2118:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2119:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2124:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2851:Ednrb UTSW 14 103821674 missense probably benign 0.04
R2852:Ednrb UTSW 14 103821674 missense probably benign 0.04
R3708:Ednrb UTSW 14 103817080 missense probably damaging 1.00
R4887:Ednrb UTSW 14 103820011 missense possibly damaging 0.95
R5626:Ednrb UTSW 14 103843128 missense probably damaging 0.98
R5802:Ednrb UTSW 14 103821714 missense probably damaging 0.97
R5834:Ednrb UTSW 14 103820877 missense probably damaging 1.00
R7212:Ednrb UTSW 14 103843008 missense probably damaging 0.96
R7368:Ednrb UTSW 14 103820017 missense probably benign 0.01
R7766:Ednrb UTSW 14 103843289 missense probably benign 0.12
R7866:Ednrb UTSW 14 103843302 missense probably benign
R7949:Ednrb UTSW 14 103843302 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTTAATTCGACTCCAAGAAGC -3'
(R):5'- TTGGACACAGGTGCCTTTTC -3'

Sequencing Primer
(F):5'- AGCAACAGCTCGATATCTGAAG -3'
(R):5'- CGTTAATCACCGGCACTCAGTG -3'
Posted On2016-11-09