Incidental Mutation 'R5834:Cntnap3'
ID449491
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
MMRRC Submission 044055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R5834 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64748577 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1028 (Y1028H)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably benign
Transcript: ENSMUST00000091554
AA Change: Y1028H

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: Y1028H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222618
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik G A 8: 105,282,123 Q421* probably null Het
Abca13 T C 11: 9,277,974 probably null Het
Adamts20 A C 15: 94,353,584 S441A probably damaging Het
Aen T A 7: 78,907,301 M299K probably damaging Het
Akap3 T C 6: 126,865,833 S472P probably benign Het
Ank3 T G 10: 69,822,257 V158G probably damaging Het
Arfgap1 A G 2: 180,981,162 D324G probably benign Het
Aste1 A T 9: 105,403,415 R448S probably benign Het
Atp10a T A 7: 58,658,618 L55Q probably benign Het
C1qtnf9 G A 14: 60,779,450 G143D probably damaging Het
Camsap2 A G 1: 136,280,388 V1122A probably benign Het
Cbl T C 9: 44,233,779 H37R probably damaging Het
Cfap61 A C 2: 146,129,149 D893A probably benign Het
Chd2 T A 7: 73,478,715 I841F probably damaging Het
Chd9 A G 8: 90,997,164 T622A probably damaging Het
Crybg2 A G 4: 134,074,123 T865A probably benign Het
Cyp2c55 A G 19: 39,042,067 I448V probably benign Het
Cyth1 T A 11: 118,192,463 probably null Het
Dcaf13 C T 15: 39,143,642 R324* probably null Het
Dhx37 C A 5: 125,425,730 R42L probably damaging Het
Dock1 T A 7: 134,763,933 V450E probably damaging Het
Ednrb A G 14: 103,820,877 L330P probably damaging Het
Eml4 T A 17: 83,477,741 H778Q probably damaging Het
Evx1 T A 6: 52,315,990 I227N probably damaging Het
G3bp1 T A 11: 55,497,940 V326E probably benign Het
Gata2 T C 6: 88,200,747 V253A probably benign Het
Gbp2 A G 3: 142,633,377 N397D probably damaging Het
Gm14401 C A 2: 177,086,903 H261N probably benign Het
Hacd4 A T 4: 88,398,152 H243Q probably benign Het
Hsd3b1 C A 3: 98,852,939 K245N possibly damaging Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ift27 A T 15: 78,165,243 C86S probably damaging Het
Iqgap2 C T 13: 95,675,372 R707H probably damaging Het
Irs3 T A 5: 137,644,559 S206C probably damaging Het
Lefty2 C T 1: 180,893,151 probably benign Het
Mark3 A G 12: 111,624,487 I162V probably damaging Het
Mefv A C 16: 3,716,046 D120E probably damaging Het
Mep1a G A 17: 43,478,164 H574Y probably benign Het
Mre11a A G 9: 14,799,657 I45V probably benign Het
Mtor A G 4: 148,536,536 N1797S possibly damaging Het
Nav1 A C 1: 135,532,406 M393R probably benign Het
Nod2 T C 8: 88,664,639 S510P possibly damaging Het
Nos2 C T 11: 78,928,579 T39I probably benign Het
Olfr474 T A 7: 107,954,906 H88Q probably benign Het
Olfr93 A T 17: 37,151,799 Y58N probably damaging Het
Pcdh7 A G 5: 57,721,628 S842G possibly damaging Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Plaa A C 4: 94,583,469 V10G probably damaging Het
Pprc1 T A 19: 46,065,220 probably benign Het
Ptprt T C 2: 161,560,269 Y994C probably damaging Het
Ripply2 T A 9: 87,015,890 W37R probably damaging Het
Rpgrip1 A G 14: 52,158,382 D1227G probably damaging Het
Scoc C T 8: 83,437,631 D10N possibly damaging Het
Sdk2 A T 11: 113,854,273 I732N probably damaging Het
Six2 T C 17: 85,687,664 K97E probably damaging Het
Slit2 A C 5: 48,259,647 N1014H probably damaging Het
Smc1b A C 15: 85,089,665 L930R probably damaging Het
Spag16 T A 1: 69,923,714 M340K probably benign Het
Spata31 C T 13: 64,922,666 S876L probably benign Het
Spen A G 4: 141,471,843 Y3135H possibly damaging Het
Spta1 A T 1: 174,184,797 probably null Het
Stk3 G A 15: 34,959,018 T336I probably damaging Het
Tas2r118 T A 6: 23,969,877 T62S probably benign Het
Tmprss11d A G 5: 86,306,310 M212T probably damaging Het
Trpc7 A G 13: 56,776,158 L738P probably damaging Het
Ttll8 A G 15: 88,917,246 V413A possibly damaging Het
Usb1 G A 8: 95,333,533 probably benign Het
Vmn1r238 T C 18: 3,123,168 E82G probably benign Het
Vmn2r114 T C 17: 23,310,625 T168A possibly damaging Het
Vmn2r60 C A 7: 42,116,508 P13H probably benign Het
Wdr26 A G 1: 181,203,147 L194P probably damaging Het
Zfhx2 G A 14: 55,073,330 Q636* probably null Het
Zfyve26 A G 12: 79,266,537 Y25H probably benign Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64757397 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACAGAGCTTGCAACTCTATTTTCC -3'
(R):5'- GAAAGTAGCAGCTTTATCCATCAG -3'

Sequencing Primer
(F):5'- GTTGCTTCTTTCCTTATTTCAGTGC -3'
(R):5'- CATTTGTGTTGCTTCCATTG -3'
Posted On2016-12-20