Incidental Mutation 'R5639:Gm11595'
ID440560
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission 043288-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5639 (G1)
Quality Score201
Status Not validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99772555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T C 8: 111,043,234 Y322H probably benign Het
Aldh1a1 C A 19: 20,623,422 T201K probably damaging Het
Ankrd26 T C 6: 118,539,724 E493G possibly damaging Het
Armc8 A G 9: 99,496,149 probably null Het
Bicc1 A T 10: 70,940,520 V701E probably damaging Het
Car11 T A 7: 45,702,621 probably null Het
Celsr1 C G 15: 86,030,767 V1002L probably damaging Het
Clpx T A 9: 65,329,830 S597T probably benign Het
Cyr61 A C 3: 145,648,697 V153G probably damaging Het
Dmpk A G 7: 19,092,600 M545V probably benign Het
Dnah7c C G 1: 46,739,668 D3139E probably benign Het
Drd5 T A 5: 38,319,835 V57D possibly damaging Het
Epc2 A G 2: 49,451,891 N29S possibly damaging Het
Ercc3 T C 18: 32,265,714 V682A probably damaging Het
Fam186a T C 15: 99,947,050 K438E unknown Het
Farp1 T A 14: 121,275,382 I764N probably damaging Het
Flvcr2 A T 12: 85,747,476 I209F probably benign Het
Fndc3b C T 3: 27,426,153 V1065M probably damaging Het
Gp6 C A 7: 4,394,131 D102Y probably damaging Het
Gpc5 T C 14: 115,092,747 L114P probably benign Het
Kcnq3 T A 15: 65,997,750 E613V probably damaging Het
Krt74 T G 15: 101,756,760 noncoding transcript Het
Lipe T C 7: 25,383,325 T801A probably benign Het
Lman1l A T 9: 57,611,866 F266I probably benign Het
Lrp1 A G 10: 127,593,839 V454A probably damaging Het
Lsm14a T C 7: 34,353,510 D338G probably damaging Het
Mctp1 T C 13: 77,024,783 silent Het
Mgea5 A G 19: 45,776,999 I123T probably damaging Het
Nlrp4a G A 7: 26,457,030 A727T probably benign Het
Nrgn T C 9: 37,546,048 S48G probably benign Het
Olfr1246 T C 2: 89,590,725 Y130C probably damaging Het
Olfr370 T C 8: 83,541,344 S67P probably damaging Het
Olfr564 A G 7: 102,803,993 S172G probably benign Het
Pdia6 A G 12: 17,278,593 E183G probably benign Het
Pign T A 1: 105,589,315 I529F probably benign Het
Plscr5 A T 9: 92,205,511 K178* probably null Het
Samm50 T G 15: 84,214,128 I456S probably benign Het
Sesn1 A G 10: 41,811,271 R84G probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Spag17 G T 3: 100,056,166 D1067Y probably damaging Het
Sptan1 C T 2: 29,990,993 Q425* probably null Het
Srrm4 T A 5: 116,591,359 I36F unknown Het
Tas1r2 A T 4: 139,659,796 S189C probably damaging Het
Tep1 A G 14: 50,853,605 V690A possibly damaging Het
Trmo T C 4: 46,382,073 K348R probably benign Het
Trmu T A 15: 85,882,698 M36K probably damaging Het
Ubr4 A G 4: 139,452,648 T3380A possibly damaging Het
Unc79 A C 12: 103,171,572 T2425P probably damaging Het
Vmn2r12 G A 5: 109,092,800 T149I probably benign Het
Vwa3a A C 7: 120,790,143 K68T probably damaging Het
Yif1a T C 19: 5,088,750 probably null Het
Zbtb44 A T 9: 31,054,052 T253S probably damaging Het
Zdhhc3 T C 9: 123,100,345 Y75C probably damaging Het
Zfp189 T A 4: 49,530,153 F419I probably benign Het
Zfp663 T C 2: 165,353,009 D430G probably benign Het
Zfp709 T G 8: 71,889,991 probably null Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R1923:Gm11595 UTSW 11 99772539 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R3807:Gm11595 UTSW 11 99772554 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5281:Gm11595 UTSW 11 99772555 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5719:Gm11595 UTSW 11 99772555 missense unknown
R5720:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6281:Gm11595 UTSW 11 99772555 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6310:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6322:Gm11595 UTSW 11 99772555 missense unknown
R6327:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
R8053:Gm11595 UTSW 11 99772128 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACACCATGGTCAGTTCCTGTTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2016-11-08