Mutagenetix > Incidental Mutation

Incidental Mutation 'R5707:Adgb'

452027

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

043332-MU

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5707 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 10391757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 940 (V940I)

Ref Sequence

ENSEMBL: ENSMUSP00000136386 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

probably benign
Transcript: ENSMUST00000148816

SMART Domains

Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	1	41	1e-19	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000172530
AA Change: V938I

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: V938I

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000179956
AA Change: V940I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: V940I

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000208717
AA Change: V914I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.0750

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

97% (56/58)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700125H20Rik	A	G	11: 85,173,312	N93S	probably benign	Het
9330182L06Rik	A	G	5: 9,441,698	Y686C	probably damaging	Het
Abca13	T	C	11: 9,510,620	L4210P	probably damaging	Het
Adcy6	T	C	15: 98,598,741	T518A	probably damaging	Het
Aqp11	A	G	7: 97,737,428	V187A	possibly damaging	Het
Arhgef15	A	G	11: 68,954,715	S104P	probably damaging	Het
BC027072	G	T	17: 71,751,572	A370E	possibly damaging	Het
Birc6	T	A	17: 74,696,404	N4762K	probably damaging	Het
Cacna1e	T	C	1: 154,633,717	D264G	probably damaging	Het
Cela3b	G	T	4: 137,424,856	Q97K	probably damaging	Het
Cenpc1	T	A	5: 86,035,434	R499W	possibly damaging	Het
Cnr1	C	A	4: 33,944,330	C239*	probably null	Het
Col6a2	T	C	10: 76,611,031	K348E	possibly damaging	Het
Ctnnb1	C	A	9: 120,955,168	L368I	probably benign	Het
Diras1	T	C	10: 81,022,081	E112G	probably benign	Het
Dopey1	T	A	9: 86,502,997	M332K	possibly damaging	Het
Dpy19l1	T	C	9: 24,414,267	*747W	probably null	Het
Dydc2	T	G	14: 41,061,954	T71P	probably damaging	Het
Ggt1	T	A	10: 75,585,238	I429N	probably benign	Het
Gm5114	G	C	7: 39,411,276	L50V	probably benign	Het
Gm5121	T	G	9: 57,334,483		noncoding transcript	Het
Kidins220	A	G	12: 25,013,391	D933G	probably damaging	Het
Kirrel3	A	G	9: 35,013,276	K286R	probably damaging	Het
Klf5	T	C	14: 99,301,508	I39T	probably benign	Het
Krt14	C	T	11: 100,204,758	V274I	possibly damaging	Het
Meiob	A	G	17: 24,835,051	D364G	probably benign	Het
Mroh7	T	A	4: 106,681,885	E1190D	possibly damaging	Het
Mtmr7	T	C	8: 40,558,162	E285G	possibly damaging	Het
Nhsl1	C	T	10: 18,526,503	T1159M	probably damaging	Het
Olfr1360	A	G	13: 21,674,599	L115P	probably damaging	Het
Olfr366	C	A	2: 37,219,889	N133K	probably benign	Het
Olfr382	G	T	11: 73,516,625	D191E	probably damaging	Het
Pdlim5	T	A	3: 142,304,299	H294L	probably damaging	Het
Pdzd8	A	T	19: 59,299,625	D1114E	probably benign	Het
Phf20	T	G	2: 156,296,771		probably null	Het
Plec	C	T	15: 76,199,671		probably benign	Het
Ppp1r18	T	C	17: 35,867,236	M1T	probably null	Het
Ppp4r3a	G	A	12: 101,058,511	T243I	probably damaging	Het
Prss41	C	T	17: 23,842,416	V134I	probably benign	Het
Pter	T	C	2: 12,978,180		probably benign	Het
Rasgef1b	T	G	5: 99,234,602	K176N	possibly damaging	Het
Reps1	T	A	10: 18,056,010	D16E	probably benign	Het
Slc4a5	T	A	6: 83,261,415	D73E	probably benign	Het
Smgc	A	T	15: 91,860,663	T146S	possibly damaging	Het
Sptbn1	A	T	11: 30,143,174	W396R	possibly damaging	Het
Stkld1	A	G	2: 26,943,987	E162G	probably damaging	Het
Tanc1	T	C	2: 59,758,530	F106L	probably benign	Het
Tarbp1	A	G	8: 126,467,144	Y340H	probably damaging	Het
Tenm2	T	C	11: 36,047,182	I1556V	possibly damaging	Het
Tmem64	T	C	4: 15,266,288	C113R	probably damaging	Het
Try4	T	C	6: 41,305,043	F188L	possibly damaging	Het
Ttc25	G	A	11: 100,554,061	A348T	probably damaging	Het
Ucn3	A	G	13: 3,941,556	V32A	probably benign	Het
Vmn2r83	T	A	10: 79,491,349	M597K	possibly damaging	Het
Wdr90	A	G	17: 25,857,192	V491A	probably benign	Het
Xylt1	T	A	7: 117,656,494	M763K	possibly damaging	Het
Zfp507	G	T	7: 35,794,163	A485E	probably damaging	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3722:Adgb	UTSW	10	10340510	missense	probably benign	0.32
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CATCTGGGATAGAGGGCATTG -3'
(R):5'- CCTAGAACCTTCTTACTTGGGG -3'

Sequencing Primer
(F):5'- GTAGCCACACAGGACCATTCTTTC -3'
(R):5'- TTCACAACCTTCTGGCTGGAAAG -3'

Posted On

2017-01-03