Incidental Mutation 'R6028:Klhl29'
ID480197
Institutional Source Beutler Lab
Gene Symbol Klhl29
Ensembl Gene ENSMUSG00000020627
Gene Namekelch-like 29
SynonymsA230106N14Rik, Kbtbd9
MMRRC Submission 044200-MU
Accession Numbers

Genbank: NM_001164493; MGI: 2683857

Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R6028 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location5077472-5375682 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 5090995 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 616 (Y616*)
Ref Sequence ENSEMBL: ENSMUSP00000020958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020958] [ENSMUST00000218384]
Predicted Effect probably null
Transcript: ENSMUST00000020958
AA Change: Y616*
SMART Domains Protein: ENSMUSP00000020958
Gene: ENSMUSG00000020627
AA Change: Y616*

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 50 75 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 260 280 N/A INTRINSIC
BTB 329 431 2.07e-22 SMART
BACK 436 538 4.88e-32 SMART
Kelch 585 636 5.33e0 SMART
Kelch 637 683 5.42e-5 SMART
Kelch 684 730 5.42e-5 SMART
Kelch 731 778 5.44e-1 SMART
Kelch 779 821 2.54e-1 SMART
Kelch 822 870 4.01e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218384
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Adck1 A T 12: 88,402,132 M127L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Ankrd33 T C 15: 101,119,072 F65S probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arhgap30 A G 1: 171,408,320 D754G probably benign Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Doc2b C A 11: 75,772,586 A347S probably benign Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
Esm1 A G 13: 113,216,667 N161S possibly damaging Het
Fbxw10 C T 11: 62,873,519 Q671* probably null Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm11639 T C 11: 104,769,655 probably null Het
Gm6803 A T 12: 88,018,361 D137E possibly damaging Het
Gpr137c C A 14: 45,277,481 Q266K probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmnb1 T G 18: 56,743,276 Y485* probably null Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Ltbp2 T A 12: 84,784,852 N1686I probably damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marco T A 1: 120,490,942 Q194L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Meltf T A 16: 31,887,476 D259E possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Mterf1b T A 5: 4,197,666 probably null Het
Muc16 G A 9: 18,657,176 S1349F unknown Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Ncl A G 1: 86,356,133 V322A probably benign Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nfia A G 4: 98,111,251 H485R possibly damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Patl2 T A 2: 122,126,137 Q158L possibly damaging Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Pkd1l1 T C 11: 8,836,267 H1929R probably benign Het
Plekhh3 A T 11: 101,166,570 M287K probably damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prkar2b A T 12: 31,993,758 D121E possibly damaging Het
Psmd3 T A 11: 98,685,665 L131Q probably damaging Het
Ptcd3 A T 6: 71,898,408 C197S probably damaging Het
Ptprf A T 4: 118,213,629 V1391D probably benign Het
Purb A G 11: 6,475,150 F246S probably damaging Het
Rgs8 C A 1: 153,690,988 T95N probably damaging Het
Slc2a13 T C 15: 91,276,116 N545S probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Srgap1 T C 10: 121,828,730 Q490R probably null Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Utrn T C 10: 12,654,716 S2118G probably benign Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Klhl29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Klhl29 APN 12 5140705 missense probably benign 0.01
IGL02639:Klhl29 APN 12 5137453 missense probably damaging 0.96
IGL03142:Klhl29 APN 12 5137603 missense probably damaging 1.00
bauxite UTSW 12 5091347 missense probably damaging 0.98
mineral UTSW 12 5083995 missense probably damaging 0.99
tungsten UTSW 12 5090995 nonsense probably null
N/A - 535:Klhl29 UTSW 12 5084019 missense probably damaging 1.00
R0347:Klhl29 UTSW 12 5084354 missense probably damaging 0.97
R0622:Klhl29 UTSW 12 5081224 missense probably damaging 1.00
R0631:Klhl29 UTSW 12 5094883 missense probably benign 0.08
R0784:Klhl29 UTSW 12 5081251 missense probably damaging 1.00
R1157:Klhl29 UTSW 12 5090650 missense possibly damaging 0.89
R1521:Klhl29 UTSW 12 5091307 missense probably damaging 1.00
R1535:Klhl29 UTSW 12 5084486 missense probably damaging 1.00
R1599:Klhl29 UTSW 12 5093538 missense probably damaging 1.00
R2049:Klhl29 UTSW 12 5137876 missense probably damaging 0.96
R2568:Klhl29 UTSW 12 5091350 missense probably damaging 0.96
R2883:Klhl29 UTSW 12 5084036 missense probably damaging 1.00
R3724:Klhl29 UTSW 12 5090603 missense probably damaging 0.99
R3951:Klhl29 UTSW 12 5140660 missense probably damaging 1.00
R5031:Klhl29 UTSW 12 5091334 missense probably benign 0.05
R5078:Klhl29 UTSW 12 5093530 missense possibly damaging 0.82
R5410:Klhl29 UTSW 12 5091366 missense probably benign 0.36
R5619:Klhl29 UTSW 12 5140587 missense probably benign 0.23
R5681:Klhl29 UTSW 12 5090669 missense possibly damaging 0.56
R6294:Klhl29 UTSW 12 5083995 missense probably damaging 0.99
R6394:Klhl29 UTSW 12 5094830 nonsense probably null
R6394:Klhl29 UTSW 12 5137720 missense probably benign 0.00
R6475:Klhl29 UTSW 12 5091030 missense probably damaging 0.98
R6737:Klhl29 UTSW 12 5210124 missense possibly damaging 0.68
R6781:Klhl29 UTSW 12 5091347 missense probably damaging 0.98
R6788:Klhl29 UTSW 12 5084393 missense probably damaging 1.00
R7741:Klhl29 UTSW 12 5137500 missense possibly damaging 0.49
Z1177:Klhl29 UTSW 12 5081152 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATACTCTGGGGCCTTGACTTTC -3'
(R):5'- GGATCCCCAAATAGCAGATGCC -3'

Sequencing Primer
(F):5'- GGGGCCTTGACTTTCCTCAG -3'
(R):5'- CAGATGCCAGAGTCAGCTG -3'
Posted On2017-06-26