Incidental Mutation 'R6028:Nfia'
ID480163
Institutional Source Beutler Lab
Gene Symbol Nfia
Ensembl Gene ENSMUSG00000028565
Gene Namenuclear factor I/A
Synonyms9430022M17Rik, NF1-A, 1110047K16Rik, NF1A
MMRRC Submission 044200-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6028 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location97772734-98118874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98111251 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 485 (H485R)
Ref Sequence ENSEMBL: ENSMUSP00000102677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052018] [ENSMUST00000075448] [ENSMUST00000092532] [ENSMUST00000107057] [ENSMUST00000107062]
Predicted Effect probably benign
Transcript: ENSMUST00000052018
SMART Domains Protein: ENSMUSP00000099856
Gene: ENSMUSG00000028565

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.6e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 192 487 7.3e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075448
SMART Domains Protein: ENSMUSP00000074899
Gene: ENSMUSG00000028565

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 6 46 5.6e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 508 1.8e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092532
SMART Domains Protein: ENSMUSP00000130032
Gene: ENSMUSG00000028565

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-30 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 318 4.1e-48 PFAM
Pfam:CTF_NFI 315 466 1.5e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107057
SMART Domains Protein: ENSMUSP00000102672
Gene: ENSMUSG00000028565

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.2e-31 PFAM
DWA 67 175 2.4e-21 SMART
Pfam:CTF_NFI 180 380 7.8e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107062
AA Change: H485R

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102677
Gene: ENSMUSG00000028565
AA Change: H485R

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 1.7e-31 PFAM
DWA 67 175 2.4e-21 SMART
low complexity region 186 201 N/A INTRINSIC
Pfam:CTF_NFI 214 494 6.2e-128 PFAM
Meta Mutation Damage Score 0.0709 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NF1 (nuclear factor 1) family of transcription factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display perinatal lethality, hydrocephalus, agenesis of the corpus callosum and hippocampal commissure. Fertility is surviving homozygotes is compromised. A decrease in the number of heterozygous animals is associated with a maternal effect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T A 3: 36,479,569 probably null Het
Acat1 A T 9: 53,592,066 Y158N probably damaging Het
Adamtsl1 C A 4: 86,342,324 A924E probably damaging Het
Adck1 A T 12: 88,402,132 M127L probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Alad G T 4: 62,510,122 T305K probably benign Het
Ankrd33 T C 15: 101,119,072 F65S probably damaging Het
Ap3d1 T C 10: 80,722,927 N281S possibly damaging Het
Arhgap30 A G 1: 171,408,320 D754G probably benign Het
Asah2 T C 19: 32,016,514 D438G probably damaging Het
Cachd1 C A 4: 100,983,556 N905K probably damaging Het
Cdh23 G T 10: 60,534,535 D160E probably damaging Het
Cntln T A 4: 84,971,173 S298T probably benign Het
Dnah5 T A 15: 28,387,833 M3146K probably damaging Het
Doc2b C A 11: 75,772,586 A347S probably benign Het
Eps8l2 T C 7: 141,357,833 F422S possibly damaging Het
Esm1 A G 13: 113,216,667 N161S possibly damaging Het
Fbxw10 C T 11: 62,873,519 Q671* probably null Het
Fnbp4 C A 2: 90,751,134 T177K probably benign Het
Gm11639 T C 11: 104,769,655 probably null Het
Gm6803 A T 12: 88,018,361 D137E possibly damaging Het
Gpr137c C A 14: 45,277,481 Q266K probably damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk1 C A 10: 62,353,058 K25N probably null Het
Klhl29 G T 12: 5,090,995 Y616* probably null Het
Lman1l A G 9: 57,608,263 I443T probably damaging Het
Lmnb1 T G 18: 56,743,276 Y485* probably null Het
Lrrc63 A G 14: 75,086,174 S537P possibly damaging Het
Ltbp2 T A 12: 84,784,852 N1686I probably damaging Het
Map9 T A 3: 82,380,248 probably null Het
Marco T A 1: 120,490,942 Q194L probably damaging Het
Mc3r A T 2: 172,249,209 D117V probably damaging Het
Meltf T A 16: 31,887,476 D259E possibly damaging Het
Mical1 A T 10: 41,486,877 M973L probably benign Het
Mmp21 T C 7: 133,678,714 T176A probably benign Het
Mterf1b T A 5: 4,197,666 probably null Het
Muc16 G A 9: 18,657,176 S1349F unknown Het
Nacc2 A G 2: 26,061,578 V415A probably damaging Het
Ncl A G 1: 86,356,133 V322A probably benign Het
Neb G A 2: 52,193,231 T1639I probably damaging Het
Nlrp9a C T 7: 26,558,337 T460I probably benign Het
Olfr1079 T A 2: 86,538,769 I49F possibly damaging Het
Olfr938 T A 9: 39,078,083 I221F probably damaging Het
Patl2 T A 2: 122,126,137 Q158L possibly damaging Het
Pja2 T C 17: 64,309,090 D270G probably benign Het
Pkd1l1 T C 11: 8,836,267 H1929R probably benign Het
Plekhh3 A T 11: 101,166,570 M287K probably damaging Het
Polb G T 8: 22,639,995 S187* probably null Het
Popdc3 A G 10: 45,317,919 D272G probably benign Het
Prkar2b A T 12: 31,993,758 D121E possibly damaging Het
Psmd3 T A 11: 98,685,665 L131Q probably damaging Het
Ptcd3 A T 6: 71,898,408 C197S probably damaging Het
Ptprf A T 4: 118,213,629 V1391D probably benign Het
Purb A G 11: 6,475,150 F246S probably damaging Het
Rgs8 C A 1: 153,690,988 T95N probably damaging Het
Slc2a13 T C 15: 91,276,116 N545S probably damaging Het
Smpd2 A G 10: 41,489,348 W51R probably damaging Het
Srgap1 T C 10: 121,828,730 Q490R probably null Het
Strbp G A 2: 37,625,255 T253I probably damaging Het
Sult1d1 A T 5: 87,559,826 M145K probably damaging Het
Taf5l A C 8: 124,002,975 probably null Het
Tas2r131 T G 6: 132,957,676 I57L probably benign Het
Tcf25 A G 8: 123,381,437 N77S possibly damaging Het
Tmem253 A G 14: 52,017,811 T57A possibly damaging Het
Tspan17 A G 13: 54,793,298 N130S probably damaging Het
Utrn T C 10: 12,654,716 S2118G probably benign Het
Vmn2r3 T A 3: 64,275,277 T334S probably benign Het
Wnk2 G T 13: 49,076,345 A901E probably damaging Het
Zc3hav1 T C 6: 38,307,340 T947A probably benign Het
Zfhx3 C T 8: 108,793,503 P419L probably damaging Het
Zfp292 A G 4: 34,819,549 S258P probably damaging Het
Zfp964 A G 8: 69,663,913 T388A unknown Het
Other mutations in Nfia
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Nfia APN 4 98065386 missense probably damaging 0.97
IGL02663:Nfia APN 4 98041619 missense probably benign 0.14
IGL02691:Nfia APN 4 98081808 nonsense probably null
IGL02705:Nfia APN 4 97783368 missense probably damaging 1.00
IGL03226:Nfia APN 4 98063049 missense probably damaging 0.97
R0400:Nfia UTSW 4 98063136 missense probably damaging 0.96
R0611:Nfia UTSW 4 97783457 missense possibly damaging 0.75
R1568:Nfia UTSW 4 98111224 missense possibly damaging 0.93
R1716:Nfia UTSW 4 98063128 missense probably damaging 0.98
R3855:Nfia UTSW 4 98063022 missense probably damaging 1.00
R4038:Nfia UTSW 4 98020837 missense probably damaging 1.00
R4441:Nfia UTSW 4 97772913 critical splice donor site probably null
R4849:Nfia UTSW 4 98081811 missense probably damaging 1.00
R5184:Nfia UTSW 4 97783348 missense probably damaging 0.99
R5201:Nfia UTSW 4 98111225 missense probably damaging 0.98
R5254:Nfia UTSW 4 98014297 missense probably damaging 0.99
R5391:Nfia UTSW 4 97783301 missense probably damaging 0.96
R5551:Nfia UTSW 4 98014260 missense probably damaging 0.98
R5794:Nfia UTSW 4 97783601 missense possibly damaging 0.92
R5905:Nfia UTSW 4 98111251 missense possibly damaging 0.82
R5965:Nfia UTSW 4 98111292 makesense probably null
R7246:Nfia UTSW 4 98065342 missense probably damaging 1.00
R7669:Nfia UTSW 4 97783505 missense probably damaging 0.96
X0018:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0019:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0020:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0021:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0022:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0023:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0024:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0027:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0050:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0052:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0053:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0054:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0057:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0058:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0060:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0061:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0062:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0063:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0064:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0065:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0066:Nfia UTSW 4 98041655 missense probably damaging 0.97
X0067:Nfia UTSW 4 98041655 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTCATCCCTCGACCACATG -3'
(R):5'- ACCATTTCCAGCACCATGAG -3'

Sequencing Primer
(F):5'- TCCCAAGGTAAATTCTGATCCCATGG -3'
(R):5'- TTTCCAGCACCATGAGAAATTACG -3'
Posted On2017-06-26