Mutagenetix > Incidental Mutations

Incidental Mutation 'R6028:Zfhx3'

480175

Institutional Source

Beutler Lab

Gene Symbol

Zfhx3

Ensembl Gene

ENSMUSG00000038872

Gene Name

zinc finger homeobox 3

Synonyms

A230102L03Rik, Atbf1, WBP9

MMRRC Submission

044200-MU

Accession Numbers

Genbank: NM_007496

Is this an essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R6028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107942644-108961630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108793503 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 419 (P419L)

Ref Sequence

ENSEMBL: ENSMUSP00000152353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043896] [ENSMUST00000188994] [ENSMUST00000220518]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043896
AA Change: P419L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044612
Gene: ENSMUSG00000038872
AA Change: P419L

Domain	Start	End	E-Value	Type
ZnF_C2H2	79	103	7.89e0	SMART
low complexity region	110	127	N/A	INTRINSIC
low complexity region	148	165	N/A	INTRINSIC
ZnF_C2H2	282	305	1.36e1	SMART
low complexity region	393	411	N/A	INTRINSIC
coiled coil region	453	496	N/A	INTRINSIC
low complexity region	500	523	N/A	INTRINSIC
ZnF_C2H2	641	664	3.47e0	SMART
ZnF_C2H2	672	695	6.78e-3	SMART
ZnF_U1	724	758	5.71e-1	SMART
ZnF_C2H2	727	751	4.87e-4	SMART
low complexity region	771	785	N/A	INTRINSIC
low complexity region	796	804	N/A	INTRINSIC
ZnF_C2H2	805	829	6.67e-2	SMART
ZnF_U1	982	1016	2.35e0	SMART
ZnF_C2H2	985	1009	4.57e0	SMART
ZnF_C2H2	1041	1065	3.99e0	SMART
ZnF_U1	1086	1120	1.36e0	SMART
ZnF_C2H2	1089	1113	1.33e-1	SMART
ZnF_C2H2	1233	1256	4.11e-2	SMART
ZnF_C2H2	1262	1285	4.34e-1	SMART
ZnF_C2H2	1370	1395	1.08e-1	SMART
ZnF_C2H2	1411	1433	3.34e-2	SMART
ZnF_C2H2	1439	1462	8.09e-1	SMART
low complexity region	1500	1512	N/A	INTRINSIC
ZnF_U1	1552	1586	1.05e0	SMART
ZnF_C2H2	1555	1579	8.22e-2	SMART
ZnF_U1	1603	1637	4.19e0	SMART
ZnF_C2H2	1606	1630	1.16e-1	SMART
low complexity region	1643	1669	N/A	INTRINSIC
low complexity region	1734	1776	N/A	INTRINSIC
low complexity region	1792	1802	N/A	INTRINSIC
low complexity region	1842	1878	N/A	INTRINSIC
low complexity region	1881	1894	N/A	INTRINSIC
low complexity region	1967	1985	N/A	INTRINSIC
ZnF_C2H2	1990	2013	1.62e0	SMART
low complexity region	2041	2088	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
HOX	2152	2214	1.13e-16	SMART
HOX	2249	2311	2.41e-20	SMART
ZnF_C2H2	2335	2355	1.72e1	SMART
low complexity region	2383	2414	N/A	INTRINSIC
low complexity region	2458	2473	N/A	INTRINSIC
low complexity region	2476	2521	N/A	INTRINSIC
ZnF_C2H2	2539	2561	1.79e-2	SMART
low complexity region	2606	2619	N/A	INTRINSIC
HOX	2650	2712	2.97e-20	SMART
ZnF_C2H2	2720	2743	7.67e-2	SMART
low complexity region	2929	2950	N/A	INTRINSIC
HOX	2954	3016	1.07e-17	SMART
ZnF_U1	3029	3063	1.8e-1	SMART
ZnF_C2H2	3032	3056	8.31e0	SMART
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3181	3235	N/A	INTRINSIC
low complexity region	3237	3256	N/A	INTRINSIC
low complexity region	3268	3282	N/A	INTRINSIC
low complexity region	3290	3299	N/A	INTRINSIC
coiled coil region	3362	3417	N/A	INTRINSIC
low complexity region	3452	3476	N/A	INTRINSIC
ZnF_C2H2	3489	3509	1.45e2	SMART
ZnF_U1	3546	3580	1.36e0	SMART
ZnF_C2H2	3549	3573	1.77e1	SMART
low complexity region	3602	3633	N/A	INTRINSIC
low complexity region	3642	3674	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188994

Predicted Effect

probably damaging
Transcript: ENSMUST00000220518
AA Change: P419L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.2253

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal initial pituitary development but reduced GH and TSH-beta staining within the pituitary by E17.5. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for the same allele exhibit partial postnatal lethality, decreased body size and prolonged conception time. [provided by MGI curators]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	A	3: 36,479,569		probably null	Het
Acat1	A	T	9: 53,592,066	Y158N	probably damaging	Het
Adamtsl1	C	A	4: 86,342,324	A924E	probably damaging	Het
Adck1	A	T	12: 88,402,132	M127L	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Alad	G	T	4: 62,510,122	T305K	probably benign	Het
Ankrd33	T	C	15: 101,119,072	F65S	probably damaging	Het
Ap3d1	T	C	10: 80,722,927	N281S	possibly damaging	Het
Arhgap30	A	G	1: 171,408,320	D754G	probably benign	Het
Asah2	T	C	19: 32,016,514	D438G	probably damaging	Het
Cachd1	C	A	4: 100,983,556	N905K	probably damaging	Het
Cdh23	G	T	10: 60,534,535	D160E	probably damaging	Het
Cntln	T	A	4: 84,971,173	S298T	probably benign	Het
Dnah5	T	A	15: 28,387,833	M3146K	probably damaging	Het
Doc2b	C	A	11: 75,772,586	A347S	probably benign	Het
Eps8l2	T	C	7: 141,357,833	F422S	possibly damaging	Het
Esm1	A	G	13: 113,216,667	N161S	possibly damaging	Het
Fbxw10	C	T	11: 62,873,519	Q671*	probably null	Het
Fnbp4	C	A	2: 90,751,134	T177K	probably benign	Het
Gm11639	T	C	11: 104,769,655		probably null	Het
Gm6803	A	T	12: 88,018,361	D137E	possibly damaging	Het
Gpr137c	C	A	14: 45,277,481	Q266K	probably damaging	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Hk1	C	A	10: 62,353,058	K25N	probably null	Het
Klhl29	G	T	12: 5,090,995	Y616*	probably null	Het
Lman1l	A	G	9: 57,608,263	I443T	probably damaging	Het
Lmnb1	T	G	18: 56,743,276	Y485*	probably null	Het
Lrrc63	A	G	14: 75,086,174	S537P	possibly damaging	Het
Ltbp2	T	A	12: 84,784,852	N1686I	probably damaging	Het
Map9	T	A	3: 82,380,248		probably null	Het
Marco	T	A	1: 120,490,942	Q194L	probably damaging	Het
Mc3r	A	T	2: 172,249,209	D117V	probably damaging	Het
Meltf	T	A	16: 31,887,476	D259E	possibly damaging	Het
Mical1	A	T	10: 41,486,877	M973L	probably benign	Het
Mmp21	T	C	7: 133,678,714	T176A	probably benign	Het
Mterf1b	T	A	5: 4,197,666		probably null	Het
Muc16	G	A	9: 18,657,176	S1349F	unknown	Het
Nacc2	A	G	2: 26,061,578	V415A	probably damaging	Het
Ncl	A	G	1: 86,356,133	V322A	probably benign	Het
Neb	G	A	2: 52,193,231	T1639I	probably damaging	Het
Nfia	A	G	4: 98,111,251	H485R	possibly damaging	Het
Nlrp9a	C	T	7: 26,558,337	T460I	probably benign	Het
Olfr1079	T	A	2: 86,538,769	I49F	possibly damaging	Het
Olfr938	T	A	9: 39,078,083	I221F	probably damaging	Het
Patl2	T	A	2: 122,126,137	Q158L	possibly damaging	Het
Pja2	T	C	17: 64,309,090	D270G	probably benign	Het
Pkd1l1	T	C	11: 8,836,267	H1929R	probably benign	Het
Plekhh3	A	T	11: 101,166,570	M287K	probably damaging	Het
Polb	G	T	8: 22,639,995	S187*	probably null	Het
Popdc3	A	G	10: 45,317,919	D272G	probably benign	Het
Prkar2b	A	T	12: 31,993,758	D121E	possibly damaging	Het
Psmd3	T	A	11: 98,685,665	L131Q	probably damaging	Het
Ptcd3	A	T	6: 71,898,408	C197S	probably damaging	Het
Ptprf	A	T	4: 118,213,629	V1391D	probably benign	Het
Purb	A	G	11: 6,475,150	F246S	probably damaging	Het
Rgs8	C	A	1: 153,690,988	T95N	probably damaging	Het
Slc2a13	T	C	15: 91,276,116	N545S	probably damaging	Het
Smpd2	A	G	10: 41,489,348	W51R	probably damaging	Het
Srgap1	T	C	10: 121,828,730	Q490R	probably null	Het
Strbp	G	A	2: 37,625,255	T253I	probably damaging	Het
Sult1d1	A	T	5: 87,559,826	M145K	probably damaging	Het
Taf5l	A	C	8: 124,002,975		probably null	Het
Tas2r131	T	G	6: 132,957,676	I57L	probably benign	Het
Tcf25	A	G	8: 123,381,437	N77S	possibly damaging	Het
Tmem253	A	G	14: 52,017,811	T57A	possibly damaging	Het
Tspan17	A	G	13: 54,793,298	N130S	probably damaging	Het
Utrn	T	C	10: 12,654,716	S2118G	probably benign	Het
Vmn2r3	T	A	3: 64,275,277	T334S	probably benign	Het
Wnk2	G	T	13: 49,076,345	A901E	probably damaging	Het
Zc3hav1	T	C	6: 38,307,340	T947A	probably benign	Het
Zfp292	A	G	4: 34,819,549	S258P	probably damaging	Het
Zfp964	A	G	8: 69,663,913	T388A	unknown	Het

Other mutations in Zfhx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Zfhx3	APN	8	108793594	missense	probably benign	0.00
IGL01946:Zfhx3	APN	8	108933929	missense	probably damaging	0.98
IGL01973:Zfhx3	APN	8	108947193	missense	probably damaging	1.00
IGL01983:Zfhx3	APN	8	108947234	missense	probably damaging	1.00
IGL02151:Zfhx3	APN	8	108793883	missense	probably damaging	1.00
IGL02405:Zfhx3	APN	8	108955742	missense	unknown
IGL02406:Zfhx3	APN	8	108955742	missense	unknown
IGL02408:Zfhx3	APN	8	108955372	splice site	probably benign
IGL02549:Zfhx3	APN	8	108800509	missense	probably damaging	1.00
IGL02601:Zfhx3	APN	8	108856830	missense	probably damaging	1.00
IGL02649:Zfhx3	APN	8	108793535	missense	possibly damaging	0.94
IGL03027:Zfhx3	APN	8	108793188	missense	probably damaging	0.98
IGL03053:Zfhx3	APN	8	108946500	missense	probably damaging	0.99
IGL03168:Zfhx3	APN	8	108946500	missense	probably damaging	0.99
IGL03194:Zfhx3	APN	8	108794727	missense	probably damaging	0.97
IGL03248:Zfhx3	APN	8	108946550	missense	probably damaging	1.00
FR4449:Zfhx3	UTSW	8	108956094	small insertion	probably benign
FR4589:Zfhx3	UTSW	8	108956101	small insertion	probably benign
FR4737:Zfhx3	UTSW	8	108956088	small insertion	probably benign
FR4737:Zfhx3	UTSW	8	108956102	small insertion	probably benign
FR4737:Zfhx3	UTSW	8	108956103	small insertion	probably benign
G5030:Zfhx3	UTSW	8	108951459	missense	possibly damaging	0.86
R0016:Zfhx3	UTSW	8	108950178	missense	probably benign	0.02
R0090:Zfhx3	UTSW	8	108950057	missense	possibly damaging	0.85
R0330:Zfhx3	UTSW	8	108948957	missense	probably damaging	1.00
R0332:Zfhx3	UTSW	8	108946623	missense	probably damaging	1.00
R0398:Zfhx3	UTSW	8	108951246	missense	probably damaging	0.98
R0539:Zfhx3	UTSW	8	108800509	missense	probably damaging	1.00
R0546:Zfhx3	UTSW	8	108794187	missense	probably damaging	1.00
R0614:Zfhx3	UTSW	8	108948539	missense	probably benign	0.03
R0614:Zfhx3	UTSW	8	108948967	nonsense	probably null
R0653:Zfhx3	UTSW	8	108946808	missense	possibly damaging	0.95
R0718:Zfhx3	UTSW	8	108955650	missense	unknown
R0825:Zfhx3	UTSW	8	108949208	missense	probably damaging	0.99
R1143:Zfhx3	UTSW	8	108794411	missense	probably damaging	1.00
R1319:Zfhx3	UTSW	8	108933833	missense	probably damaging	0.99
R1347:Zfhx3	UTSW	8	108800698	splice site	probably benign
R1412:Zfhx3	UTSW	8	108914567	missense	possibly damaging	0.88
R1447:Zfhx3	UTSW	8	108948444	missense	probably benign	0.03
R1530:Zfhx3	UTSW	8	108948489	missense	probably damaging	1.00
R1745:Zfhx3	UTSW	8	108955862	missense	unknown
R1764:Zfhx3	UTSW	8	108951644	missense	probably benign	0.18
R1781:Zfhx3	UTSW	8	108793535	missense	probably benign	0.01
R1917:Zfhx3	UTSW	8	108956248	missense	unknown
R1956:Zfhx3	UTSW	8	108794142	missense	probably benign	0.02
R2049:Zfhx3	UTSW	8	108945177	missense	probably benign	0.01
R2196:Zfhx3	UTSW	8	108800253	missense	probably damaging	1.00
R3085:Zfhx3	UTSW	8	108956032	missense	unknown
R3765:Zfhx3	UTSW	8	108792762	missense	probably damaging	0.97
R4162:Zfhx3	UTSW	8	108956987	missense	unknown
R4243:Zfhx3	UTSW	8	108792320	missense	probably damaging	0.97
R4380:Zfhx3	UTSW	8	108956390	missense	unknown
R4433:Zfhx3	UTSW	8	108955637	missense	unknown
R4509:Zfhx3	UTSW	8	108793779	missense	probably benign	0.01
R4731:Zfhx3	UTSW	8	108956084	missense	unknown
R4788:Zfhx3	UTSW	8	108794210	missense	probably damaging	1.00
R4812:Zfhx3	UTSW	8	108947961	missense	possibly damaging	0.83
R4893:Zfhx3	UTSW	8	108957007	missense	unknown
R4907:Zfhx3	UTSW	8	108793354	missense	probably damaging	0.99
R4935:Zfhx3	UTSW	8	108947850	missense	possibly damaging	0.92
R4943:Zfhx3	UTSW	8	108948317	missense	probably damaging	0.98
R5154:Zfhx3	UTSW	8	108800575	missense	probably damaging	1.00
R5377:Zfhx3	UTSW	8	108951185	missense	possibly damaging	0.95
R5388:Zfhx3	UTSW	8	108946814	missense	possibly damaging	0.88
R5434:Zfhx3	UTSW	8	108792399	missense	probably damaging	0.99
R5445:Zfhx3	UTSW	8	108956210	missense	unknown
R5541:Zfhx3	UTSW	8	108948951	missense	probably damaging	0.99
R5571:Zfhx3	UTSW	8	108955991	missense	unknown
R5700:Zfhx3	UTSW	8	108933867	missense	probably damaging	1.00
R5754:Zfhx3	UTSW	8	108800332	missense	probably damaging	0.99
R5867:Zfhx3	UTSW	8	108793446	missense	probably damaging	1.00
R5905:Zfhx3	UTSW	8	108793503	missense	probably damaging	1.00
R5922:Zfhx3	UTSW	8	108946698	missense	probably damaging	1.00
R5972:Zfhx3	UTSW	8	108950851	missense	possibly damaging	0.91
R6020:Zfhx3	UTSW	8	108792527	missense	probably damaging	1.00
R6113:Zfhx3	UTSW	8	108947421	missense	probably benign	0.04
R6253:Zfhx3	UTSW	8	108955388	missense	possibly damaging	0.96
R6356:Zfhx3	UTSW	8	108946619	missense	probably damaging	1.00
R6800:Zfhx3	UTSW	8	108949517	missense	probably benign	0.20
R6829:Zfhx3	UTSW	8	108950283	missense	probably damaging	0.98
R6872:Zfhx3	UTSW	8	108800641	missense	probably damaging	1.00
R6873:Zfhx3	UTSW	8	108800641	missense	probably damaging	1.00
R6919:Zfhx3	UTSW	8	108800528	missense	probably damaging	1.00
R6921:Zfhx3	UTSW	8	108951392	missense	possibly damaging	0.53
R6925:Zfhx3	UTSW	8	108956821	missense	unknown
R6927:Zfhx3	UTSW	8	108956821	missense	unknown
R7152:Zfhx3	UTSW	8	108948207	missense	possibly damaging	0.94
R7169:Zfhx3	UTSW	8	108951398	missense	possibly damaging	0.86
R7214:Zfhx3	UTSW	8	108948861	missense	probably damaging	0.98
R7378:Zfhx3	UTSW	8	108793248	missense	probably damaging	0.99
R7391:Zfhx3	UTSW	8	108947843	missense	probably damaging	0.96
R7442:Zfhx3	UTSW	8	108792836	missense	probably damaging	0.97
R7636:Zfhx3	UTSW	8	108946809	missense	probably benign	0.25
R7649:Zfhx3	UTSW	8	108951644	missense	probably benign	0.18
R7728:Zfhx3	UTSW	8	108951569	missense	probably benign	0.01
R7780:Zfhx3	UTSW	8	108951651	missense	possibly damaging	0.53
R7904:Zfhx3	UTSW	8	108951063	missense	probably damaging	0.98
R7987:Zfhx3	UTSW	8	108951063	missense	probably damaging	0.98
R8032:Zfhx3	UTSW	8	108951222	missense	possibly damaging	0.51
RF012:Zfhx3	UTSW	8	108956093	small insertion	probably benign
RF021:Zfhx3	UTSW	8	108956093	small insertion	probably benign
RF027:Zfhx3	UTSW	8	108956098	small insertion	probably benign
RF028:Zfhx3	UTSW	8	108956096	small insertion	probably benign
RF029:Zfhx3	UTSW	8	108956092	small insertion	probably benign
RF031:Zfhx3	UTSW	8	108956098	small insertion	probably benign
RF032:Zfhx3	UTSW	8	108956092	small insertion	probably benign
RF037:Zfhx3	UTSW	8	108956098	nonsense	probably null
RF038:Zfhx3	UTSW	8	108956101	small insertion	probably benign
RF040:Zfhx3	UTSW	8	108956101	small insertion	probably benign
RF042:Zfhx3	UTSW	8	108956088	small insertion	probably benign
RF042:Zfhx3	UTSW	8	108956098	small insertion	probably benign
RF054:Zfhx3	UTSW	8	108956096	small insertion	probably benign
RF060:Zfhx3	UTSW	8	108956088	small insertion	probably benign
X0019:Zfhx3	UTSW	8	108951653	missense	probably benign	0.00
X0026:Zfhx3	UTSW	8	108949145	missense	probably damaging	1.00
Z1088:Zfhx3	UTSW	8	108951357	missense	possibly damaging	0.72
Z1176:Zfhx3	UTSW	8	108793923	missense	probably benign	0.09
Z1176:Zfhx3	UTSW	8	108800449	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCCACAGCTAACCTCATAGGC -3'
(R):5'- TCCAGGTCATTTGGAAAGAGTC -3'

Sequencing Primer
(F):5'- TAGGCCCCGGACACAGTTTTTATG -3'
(R):5'- GAAAGAGTCCTTTGCAGCCCTC -3'

Posted On

2017-06-26