Mutagenetix > Incidental Mutations

Incidental Mutation 'R6034:Zc3h14'

480572

Institutional Source

Beutler Lab

Gene Symbol

Zc3h14

Ensembl Gene

ENSMUSG00000021012

Gene Name

zinc finger CCCH type containing 14

Synonyms

1700016A15Rik, 1010001P15Rik, 2700069A02Rik

MMRRC Submission

044206-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6034 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98746964-98787753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98771373 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 40 (S40P)

Ref Sequence

ENSEMBL: ENSMUSP00000021399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532]

Predicted Effect

probably benign
Transcript: ENSMUST00000021399
AA Change: S40P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012
AA Change: S40P

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
coiled coil region	69	91	N/A	INTRINSIC
ZnF_C3H1	170	193	7.16e-1	SMART
ZnF_C3H1	195	214	5.27e1	SMART
ZnF_C3H1	250	272	5.55e0	SMART
Pfam:zf-CCCH_2	273	290	1.3e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000057000

SMART Domains

Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	440	463	7.16e-1	SMART
ZnF_C3H1	465	484	5.27e1	SMART
ZnF_C3H1	520	542	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110104

SMART Domains

Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	465	488	7.16e-1	SMART
ZnF_C3H1	490	509	5.27e1	SMART
ZnF_C3H1	545	567	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110105

SMART Domains

Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	596	619	7.16e-1	SMART
ZnF_C3H1	621	640	5.27e1	SMART
ZnF_C3H1	676	698	5.55e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220865

Predicted Effect

probably benign
Transcript: ENSMUST00000221532

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221576

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222461

Predicted Effect

probably benign
Transcript: ENSMUST00000223451

Meta Mutation Damage Score

0.1366

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 96.4%
20x: 87.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef4	G	T	1: 34,721,903	G80V	unknown	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Atad2	A	T	15: 58,108,563	L306Q	probably damaging	Het
Atp2b4	T	A	1: 133,731,907		probably null	Het
Atp6v1c2	C	A	12: 17,307,500	G95V	possibly damaging	Het
Birc6	T	A	17: 74,615,283	V2192E	probably damaging	Het
Catsperb	A	G	12: 101,575,832	E597G	probably benign	Het
Ccdc129	T	A	6: 55,967,681	D462E	possibly damaging	Het
Ccdc40	A	G	11: 119,243,072	M556V	possibly damaging	Het
Ccin	G	A	4: 43,985,354	R587K	probably benign	Het
Cdipt	T	G	7: 126,978,325	V81G	probably damaging	Het
Cfh	T	C	1: 140,163,131	K40E	probably damaging	Het
Col4a3bp	A	C	13: 96,609,800	I236L	probably benign	Het
Cps1	T	A	1: 67,157,713		probably null	Het
Dnah7c	A	T	1: 46,457,258	D101V	probably benign	Het
Fastkd3	T	A	13: 68,583,610	W17R	probably damaging	Het
H2-Ob	T	C	17: 34,241,218	V30A	probably damaging	Het
Hist1h1e	A	G	13: 23,622,313	L62P	probably damaging	Het
Hmgxb3	T	A	18: 61,132,522	H1128L	probably damaging	Het
Hspbp1	A	T	7: 4,677,712	I255N	probably damaging	Het
Imp4	A	G	1: 34,443,456	D91G	probably damaging	Het
Kcnip4	G	T	5: 48,390,941	R241S	possibly damaging	Het
Lilra5	T	C	7: 4,242,134	L259P	probably benign	Het
Lipf	T	C	19: 33,964,889	I73T	probably benign	Het
Lsm7	T	C	10: 80,852,908		probably null	Het
Luzp2	T	A	7: 55,167,224	L141M	probably damaging	Het
Malrd1	T	A	2: 15,845,326	V1252E	possibly damaging	Het
Map10	T	C	8: 125,672,466	L866P	probably damaging	Het
Mink1	AAGCAGCAGCAGCAGCAGCAGCAG	AAGCAGCAGCAGCAGCAGCAG	11: 70,607,040		probably benign	Het
Mpp2	T	C	11: 102,061,634	I355V	possibly damaging	Het
Mtrf1l	T	A	10: 5,823,834		probably benign	Het
Myo5c	A	T	9: 75,255,905	T339S	probably benign	Het
Naa15	A	G	3: 51,442,821	D163G	probably damaging	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1303	T	A	2: 111,814,357	Y123F	probably damaging	Het
Oosp2	A	G	19: 11,651,515	F74S	probably damaging	Het
Pard3	C	G	8: 127,064,327		probably benign	Het
Pcdha1	T	A	18: 36,930,598	I105N	probably damaging	Het
Pcdhgb8	A	G	18: 37,762,548	T224A	possibly damaging	Het
Phf12	A	G	11: 78,018,069	N325S	probably benign	Het
Prom1	T	A	5: 44,044,408		probably null	Het
Raet1e	A	G	10: 22,182,091	*252W	probably null	Het
Sap130	T	C	18: 31,689,406	V655A	possibly damaging	Het
Sec16b	A	T	1: 157,552,939	K360I	probably damaging	Het
Sec23ip	C	T	7: 128,750,203	T101I	possibly damaging	Het
Selenoo	A	G	15: 89,099,343	K529R	probably benign	Het
Slc22a15	A	G	3: 101,862,919	F451L	possibly damaging	Het
St6gal2	T	A	17: 55,482,981	S339T	probably benign	Het
Stard13	A	T	5: 151,095,500		probably null	Het
Synm	A	G	7: 67,734,905	V561A	probably damaging	Het
Tc2n	A	T	12: 101,651,201		probably null	Het
Ugt2b36	T	A	5: 87,081,518	D236V	probably damaging	Het
Vmn1r65	A	G	7: 6,008,869	L122P	probably damaging	Het
Zc3hav1l	C	A	6: 38,295,280	G185C	probably damaging	Het
Zfp563	G	A	17: 33,104,961	A177T	probably damaging	Het

Other mutations in Zc3h14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Zc3h14	APN	12	98747524	critical splice donor site	probably null
IGL00946:Zc3h14	APN	12	98759883	splice site	probably benign
IGL00969:Zc3h14	APN	12	98758843	missense	probably benign	0.00
IGL01626:Zc3h14	APN	12	98779186	missense	possibly damaging	0.72
IGL01891:Zc3h14	APN	12	98758947	unclassified	probably benign
IGL02119:Zc3h14	APN	12	98763895	missense	probably benign	0.00
IGL02484:Zc3h14	APN	12	98774301	missense	probably benign	0.14
IGL02744:Zc3h14	APN	12	98784975	missense	possibly damaging	0.67
IGL02894:Zc3h14	APN	12	98758943	critical splice donor site	probably null
R0408:Zc3h14	UTSW	12	98763823	missense	probably damaging	1.00
R0739:Zc3h14	UTSW	12	98757201	missense	probably damaging	0.99
R0865:Zc3h14	UTSW	12	98779269	critical splice donor site	probably null
R0926:Zc3h14	UTSW	12	98758590	missense	possibly damaging	0.94
R1530:Zc3h14	UTSW	12	98785003	missense	probably damaging	1.00
R1735:Zc3h14	UTSW	12	98758580	missense	probably damaging	1.00
R1743:Zc3h14	UTSW	12	98779189	missense	probably benign	0.04
R1848:Zc3h14	UTSW	12	98752832	missense	possibly damaging	0.89
R1851:Zc3h14	UTSW	12	98760354	nonsense	probably null
R1978:Zc3h14	UTSW	12	98763922	missense	probably damaging	0.97
R2011:Zc3h14	UTSW	12	98780268	missense	possibly damaging	0.76
R2198:Zc3h14	UTSW	12	98752809	missense	probably damaging	1.00
R2198:Zc3h14	UTSW	12	98752810	missense	possibly damaging	0.94
R2263:Zc3h14	UTSW	12	98758514	missense	probably benign	0.32
R3762:Zc3h14	UTSW	12	98758643	missense	probably damaging	1.00
R4210:Zc3h14	UTSW	12	98785399	missense	probably damaging	1.00
R4353:Zc3h14	UTSW	12	98763960	missense	possibly damaging	0.70
R4360:Zc3h14	UTSW	12	98780197	missense	probably benign	0.09
R4814:Zc3h14	UTSW	12	98752848	missense	probably damaging	1.00
R4815:Zc3h14	UTSW	12	98752848	missense	probably damaging	1.00
R4817:Zc3h14	UTSW	12	98752848	missense	probably damaging	1.00
R4947:Zc3h14	UTSW	12	98759824	missense	probably benign
R5077:Zc3h14	UTSW	12	98757206	critical splice donor site	probably null
R5431:Zc3h14	UTSW	12	98780065	missense	possibly damaging	0.94
R5783:Zc3h14	UTSW	12	98757175	missense	probably damaging	0.99
R5850:Zc3h14	UTSW	12	98779155	missense	probably damaging	0.97
R6034:Zc3h14	UTSW	12	98771373	missense	probably benign	0.01
R6291:Zc3h14	UTSW	12	98759828	missense	probably damaging	1.00
R6338:Zc3h14	UTSW	12	98758590	missense	possibly damaging	0.94
R6595:Zc3h14	UTSW	12	98757026	missense	probably damaging	0.98
R6737:Zc3h14	UTSW	12	98785046	missense	probably damaging	1.00
R6932:Zc3h14	UTSW	12	98771077	intron	probably benign
R7074:Zc3h14	UTSW	12	98758600	missense	possibly damaging	0.96
R7204:Zc3h14	UTSW	12	98771356	missense	probably damaging	1.00
R7237:Zc3h14	UTSW	12	98780149	missense	probably benign	0.34
R7267:Zc3h14	UTSW	12	98785729	missense	probably damaging	1.00

Predicted Primers

Posted On

2017-06-26