Incidental Mutation 'R4360:Zc3h14'
Institutional Source Beutler Lab
Gene Symbol Zc3h14
Ensembl Gene ENSMUSG00000021012
Gene Namezinc finger CCCH type containing 14
Synonyms1700016A15Rik, 1010001P15Rik, 2700069A02Rik
MMRRC Submission 041111-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4360 (G1)
Quality Score225
Status Validated
Chromosomal Location98746964-98787753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98780197 bp
Amino Acid Change Lysine to Arginine at position 555 (K555R)
Ref Sequence ENSEMBL: ENSMUSP00000105732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532]
Predicted Effect probably benign
Transcript: ENSMUST00000021399
SMART Domains Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012

low complexity region 4 20 N/A INTRINSIC
coiled coil region 69 91 N/A INTRINSIC
ZnF_C3H1 170 193 7.16e-1 SMART
ZnF_C3H1 195 214 5.27e1 SMART
ZnF_C3H1 250 272 5.55e0 SMART
Pfam:zf-CCCH_2 273 290 1.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057000
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110104
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110105
AA Change: K555R

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012
AA Change: K555R

low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220660
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222632
Predicted Effect probably benign
Transcript: ENSMUST00000223451
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 66,938,401 noncoding transcript Het
Adgra3 T C 5: 49,990,210 E496G possibly damaging Het
Atg14 C G 14: 47,568,370 E13Q probably benign Het
BC023105 G T 18: 60,442,001 noncoding transcript Het
Chd6 A G 2: 160,949,856 V2527A possibly damaging Het
Csn1s2a G T 5: 87,781,841 V100L possibly damaging Het
Fah G A 7: 84,589,648 L330F probably damaging Het
Fmo2 T C 1: 162,882,014 N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Frmd4a A T 2: 4,601,241 H287L probably damaging Het
G2e3 T A 12: 51,363,414 probably benign Het
Gm1758 A T 16: 14,506,351 noncoding transcript Het
Gm7204 T C 16: 48,218,833 noncoding transcript Het
Gm829 T C 4: 45,718,819 noncoding transcript Het
Hspa14 A G 2: 3,502,523 V116A possibly damaging Het
Hspa4 T C 11: 53,265,092 Y662C probably damaging Het
Islr T A 9: 58,157,604 N207Y probably damaging Het
Lipc T C 9: 70,852,582 probably benign Het
Ncor2 A G 5: 125,028,972 S1546P probably damaging Het
Olfr539 T C 7: 140,667,817 F170L probably damaging Het
Olfr679 A C 7: 105,086,253 E179A probably damaging Het
Olfr830 G A 9: 18,875,717 C127Y probably damaging Het
Parp4 A G 14: 56,629,204 D1075G possibly damaging Het
Pkp2 A G 16: 16,268,682 I736V probably benign Het
Plekha8 T C 6: 54,622,186 I235T probably benign Het
Polq A G 16: 37,060,339 D955G probably benign Het
Pramef25 A G 4: 143,950,863 F49L possibly damaging Het
Psmd1 A G 1: 86,133,737 K890E probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scpep1 A G 11: 88,930,244 Y366H possibly damaging Het
Slc18a3 A G 14: 32,463,925 V167A probably benign Het
Sp8 A G 12: 118,848,665 D85G possibly damaging Het
Stard3nl G A 13: 19,370,484 S144L probably damaging Het
Stk4 A G 2: 164,088,959 E160G possibly damaging Het
Tbcb T C 7: 30,227,035 N119S probably benign Het
Tnc G T 4: 64,016,924 R592S probably benign Het
Trem3 T A 17: 48,249,773 S91T probably benign Het
Trpc6 A G 9: 8,610,266 E245G probably benign Het
Usp40 C T 1: 87,952,361 R1036H probably damaging Het
Usp47 G T 7: 112,054,932 G112C probably damaging Het
Wdr35 T C 12: 8,974,149 probably benign Het
Zfp26 T C 9: 20,438,573 S232G probably benign Het
Zfp811 T C 17: 32,798,458 T202A probably benign Het
Other mutations in Zc3h14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Zc3h14 APN 12 98747524 critical splice donor site probably null
IGL00946:Zc3h14 APN 12 98759883 splice site probably benign
IGL00969:Zc3h14 APN 12 98758843 missense probably benign 0.00
IGL01626:Zc3h14 APN 12 98779186 missense possibly damaging 0.72
IGL01891:Zc3h14 APN 12 98758947 unclassified probably benign
IGL02119:Zc3h14 APN 12 98763895 missense probably benign 0.00
IGL02484:Zc3h14 APN 12 98774301 missense probably benign 0.14
IGL02744:Zc3h14 APN 12 98784975 missense possibly damaging 0.67
IGL02894:Zc3h14 APN 12 98758943 critical splice donor site probably null
R0408:Zc3h14 UTSW 12 98763823 missense probably damaging 1.00
R0739:Zc3h14 UTSW 12 98757201 missense probably damaging 0.99
R0865:Zc3h14 UTSW 12 98779269 critical splice donor site probably null
R0926:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R1530:Zc3h14 UTSW 12 98785003 missense probably damaging 1.00
R1735:Zc3h14 UTSW 12 98758580 missense probably damaging 1.00
R1743:Zc3h14 UTSW 12 98779189 missense probably benign 0.04
R1848:Zc3h14 UTSW 12 98752832 missense possibly damaging 0.89
R1851:Zc3h14 UTSW 12 98760354 nonsense probably null
R1978:Zc3h14 UTSW 12 98763922 missense probably damaging 0.97
R2011:Zc3h14 UTSW 12 98780268 missense possibly damaging 0.76
R2198:Zc3h14 UTSW 12 98752809 missense probably damaging 1.00
R2198:Zc3h14 UTSW 12 98752810 missense possibly damaging 0.94
R2263:Zc3h14 UTSW 12 98758514 missense probably benign 0.32
R3762:Zc3h14 UTSW 12 98758643 missense probably damaging 1.00
R4210:Zc3h14 UTSW 12 98785399 missense probably damaging 1.00
R4353:Zc3h14 UTSW 12 98763960 missense possibly damaging 0.70
R4814:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4815:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4817:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4947:Zc3h14 UTSW 12 98759824 missense probably benign
R5077:Zc3h14 UTSW 12 98757206 critical splice donor site probably null
R5431:Zc3h14 UTSW 12 98780065 missense possibly damaging 0.94
R5783:Zc3h14 UTSW 12 98757175 missense probably damaging 0.99
R5850:Zc3h14 UTSW 12 98779155 missense probably damaging 0.97
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6291:Zc3h14 UTSW 12 98759828 missense probably damaging 1.00
R6338:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R6595:Zc3h14 UTSW 12 98757026 missense probably damaging 0.98
R6737:Zc3h14 UTSW 12 98785046 missense probably damaging 1.00
R6932:Zc3h14 UTSW 12 98771077 intron probably benign
R7074:Zc3h14 UTSW 12 98758600 missense possibly damaging 0.96
R7204:Zc3h14 UTSW 12 98771356 missense probably damaging 1.00
R7237:Zc3h14 UTSW 12 98780149 missense probably benign 0.34
R7267:Zc3h14 UTSW 12 98785729 missense probably damaging 1.00
RF020:Zc3h14 UTSW 12 98780282 critical splice donor site probably null
RF024:Zc3h14 UTSW 12 98758861 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06