Incidental Mutation 'R4360:Zc3h14'
ID 324867
Institutional Source Beutler Lab
Gene Symbol Zc3h14
Ensembl Gene ENSMUSG00000021012
Gene Name zinc finger CCCH type containing 14
Synonyms 2700069A02Rik, 1010001P15Rik, 1700016A15Rik
MMRRC Submission 041111-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4360 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 98713223-98754012 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98746456 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 555 (K555R)
Ref Sequence ENSEMBL: ENSMUSP00000105732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532]
AlphaFold Q8BJ05
Predicted Effect probably benign
Transcript: ENSMUST00000021399
SMART Domains Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 69 91 N/A INTRINSIC
ZnF_C3H1 170 193 7.16e-1 SMART
ZnF_C3H1 195 214 5.27e1 SMART
ZnF_C3H1 250 272 5.55e0 SMART
Pfam:zf-CCCH_2 273 290 1.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057000
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110104
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110105
AA Change: K555R

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012
AA Change: K555R

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220660
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222632
Predicted Effect probably benign
Transcript: ENSMUST00000223451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222146
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik T C 14: 67,175,850 (GRCm39) noncoding transcript Het
Adgra3 T C 5: 50,147,552 (GRCm39) E496G possibly damaging Het
Atg14 C G 14: 47,805,827 (GRCm39) E13Q probably benign Het
BC023105 G T 18: 60,575,073 (GRCm39) noncoding transcript Het
Chd6 A G 2: 160,791,776 (GRCm39) V2527A possibly damaging Het
Csn1s2a G T 5: 87,929,700 (GRCm39) V100L possibly damaging Het
Fah G A 7: 84,238,856 (GRCm39) L330F probably damaging Het
Fmo2 T C 1: 162,709,583 (GRCm39) N268S probably damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,431,475 (GRCm39) probably benign Het
Frmd4a A T 2: 4,606,052 (GRCm39) H287L probably damaging Het
G2e3 T A 12: 51,410,197 (GRCm39) probably benign Het
Gm1758 A T 16: 14,324,215 (GRCm39) noncoding transcript Het
Gm7204 T C 16: 48,039,196 (GRCm39) noncoding transcript Het
Gm829 T C 4: 45,718,819 (GRCm39) noncoding transcript Het
Hspa14 A G 2: 3,503,560 (GRCm39) V116A possibly damaging Het
Hspa4 T C 11: 53,155,919 (GRCm39) Y662C probably damaging Het
Islr T A 9: 58,064,887 (GRCm39) N207Y probably damaging Het
Lipc T C 9: 70,759,864 (GRCm39) probably benign Het
Ncor2 A G 5: 125,106,036 (GRCm39) S1546P probably damaging Het
Or13a25 T C 7: 140,247,730 (GRCm39) F170L probably damaging Het
Or56a3 A C 7: 104,735,460 (GRCm39) E179A probably damaging Het
Or7g18 G A 9: 18,787,013 (GRCm39) C127Y probably damaging Het
Parp4 A G 14: 56,866,661 (GRCm39) D1075G possibly damaging Het
Pkp2 A G 16: 16,086,546 (GRCm39) I736V probably benign Het
Plekha8 T C 6: 54,599,171 (GRCm39) I235T probably benign Het
Polq A G 16: 36,880,701 (GRCm39) D955G probably benign Het
Pramel16 A G 4: 143,677,433 (GRCm39) F49L possibly damaging Het
Psmd1 A G 1: 86,061,459 (GRCm39) K890E probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Scpep1 A G 11: 88,821,070 (GRCm39) Y366H possibly damaging Het
Slc18a3 A G 14: 32,185,882 (GRCm39) V167A probably benign Het
Sp8 A G 12: 118,812,400 (GRCm39) D85G possibly damaging Het
Stard3nl G A 13: 19,554,654 (GRCm39) S144L probably damaging Het
Stk4 A G 2: 163,930,879 (GRCm39) E160G possibly damaging Het
Tbcb T C 7: 29,926,460 (GRCm39) N119S probably benign Het
Tnc G T 4: 63,935,161 (GRCm39) R592S probably benign Het
Trem3 T A 17: 48,556,801 (GRCm39) S91T probably benign Het
Trpc6 A G 9: 8,610,267 (GRCm39) E245G probably benign Het
Usp40 C T 1: 87,880,083 (GRCm39) R1036H probably damaging Het
Usp47 G T 7: 111,654,139 (GRCm39) G112C probably damaging Het
Wdr35 T C 12: 9,024,149 (GRCm39) probably benign Het
Zfp26 T C 9: 20,349,869 (GRCm39) S232G probably benign Het
Zfp811 T C 17: 33,017,432 (GRCm39) T202A probably benign Het
Other mutations in Zc3h14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Zc3h14 APN 12 98,713,783 (GRCm39) critical splice donor site probably null
IGL00946:Zc3h14 APN 12 98,726,142 (GRCm39) splice site probably benign
IGL00969:Zc3h14 APN 12 98,725,102 (GRCm39) missense probably benign 0.00
IGL01626:Zc3h14 APN 12 98,745,445 (GRCm39) missense possibly damaging 0.72
IGL01891:Zc3h14 APN 12 98,725,206 (GRCm39) unclassified probably benign
IGL02119:Zc3h14 APN 12 98,730,154 (GRCm39) missense probably benign 0.00
IGL02484:Zc3h14 APN 12 98,740,560 (GRCm39) missense probably benign 0.14
IGL02744:Zc3h14 APN 12 98,751,234 (GRCm39) missense possibly damaging 0.67
IGL02894:Zc3h14 APN 12 98,725,202 (GRCm39) critical splice donor site probably null
R0408:Zc3h14 UTSW 12 98,730,082 (GRCm39) missense probably damaging 1.00
R0739:Zc3h14 UTSW 12 98,723,460 (GRCm39) missense probably damaging 0.99
R0865:Zc3h14 UTSW 12 98,745,528 (GRCm39) critical splice donor site probably null
R0926:Zc3h14 UTSW 12 98,724,849 (GRCm39) missense possibly damaging 0.94
R1530:Zc3h14 UTSW 12 98,751,262 (GRCm39) missense probably damaging 1.00
R1735:Zc3h14 UTSW 12 98,724,839 (GRCm39) missense probably damaging 1.00
R1743:Zc3h14 UTSW 12 98,745,448 (GRCm39) missense probably benign 0.04
R1848:Zc3h14 UTSW 12 98,719,091 (GRCm39) missense possibly damaging 0.89
R1851:Zc3h14 UTSW 12 98,726,613 (GRCm39) nonsense probably null
R1978:Zc3h14 UTSW 12 98,730,181 (GRCm39) missense probably damaging 0.97
R2011:Zc3h14 UTSW 12 98,746,527 (GRCm39) missense possibly damaging 0.76
R2198:Zc3h14 UTSW 12 98,719,069 (GRCm39) missense possibly damaging 0.94
R2198:Zc3h14 UTSW 12 98,719,068 (GRCm39) missense probably damaging 1.00
R2263:Zc3h14 UTSW 12 98,724,773 (GRCm39) missense probably benign 0.32
R3762:Zc3h14 UTSW 12 98,724,902 (GRCm39) missense probably damaging 1.00
R4210:Zc3h14 UTSW 12 98,751,658 (GRCm39) missense probably damaging 1.00
R4353:Zc3h14 UTSW 12 98,730,219 (GRCm39) missense possibly damaging 0.70
R4814:Zc3h14 UTSW 12 98,719,107 (GRCm39) missense probably damaging 1.00
R4815:Zc3h14 UTSW 12 98,719,107 (GRCm39) missense probably damaging 1.00
R4817:Zc3h14 UTSW 12 98,719,107 (GRCm39) missense probably damaging 1.00
R4947:Zc3h14 UTSW 12 98,726,083 (GRCm39) missense probably benign
R5077:Zc3h14 UTSW 12 98,723,465 (GRCm39) critical splice donor site probably null
R5431:Zc3h14 UTSW 12 98,746,324 (GRCm39) missense possibly damaging 0.94
R5783:Zc3h14 UTSW 12 98,723,434 (GRCm39) missense probably damaging 0.99
R5850:Zc3h14 UTSW 12 98,745,414 (GRCm39) missense probably damaging 0.97
R6034:Zc3h14 UTSW 12 98,737,632 (GRCm39) missense probably benign 0.01
R6034:Zc3h14 UTSW 12 98,737,632 (GRCm39) missense probably benign 0.01
R6291:Zc3h14 UTSW 12 98,726,087 (GRCm39) missense probably damaging 1.00
R6338:Zc3h14 UTSW 12 98,724,849 (GRCm39) missense possibly damaging 0.94
R6595:Zc3h14 UTSW 12 98,723,285 (GRCm39) missense probably damaging 0.98
R6737:Zc3h14 UTSW 12 98,751,305 (GRCm39) missense probably damaging 1.00
R6932:Zc3h14 UTSW 12 98,737,336 (GRCm39) intron probably benign
R7074:Zc3h14 UTSW 12 98,724,859 (GRCm39) missense possibly damaging 0.96
R7204:Zc3h14 UTSW 12 98,737,615 (GRCm39) missense probably damaging 1.00
R7237:Zc3h14 UTSW 12 98,746,408 (GRCm39) missense probably benign 0.34
R7267:Zc3h14 UTSW 12 98,751,988 (GRCm39) missense probably damaging 1.00
R8753:Zc3h14 UTSW 12 98,724,831 (GRCm39) missense probably benign 0.12
R9169:Zc3h14 UTSW 12 98,745,505 (GRCm39) missense probably damaging 1.00
R9610:Zc3h14 UTSW 12 98,737,663 (GRCm39) missense possibly damaging 0.92
RF020:Zc3h14 UTSW 12 98,746,541 (GRCm39) critical splice donor site probably null
RF024:Zc3h14 UTSW 12 98,725,120 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTAGGAGGCTCAGCATTTTG -3'
(R):5'- TATAAGCGAGGCCTCAAACC -3'

Sequencing Primer
(F):5'- AGGAGGCTCAGCATTTTGTGTTC -3'
(R):5'- GCGAGGCCTCAAACCAATATTC -3'
Posted On 2015-07-06