Incidental Mutation 'R5987:Epor'
ID481739
Institutional Source Beutler Lab
Gene Symbol Epor
Ensembl Gene ENSMUSG00000006235
Gene Nameerythropoietin receptor
Synonyms
MMRRC Submission 044167-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5987 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location21958897-21963506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21962276 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 59 (D59G)
Ref Sequence ENSEMBL: ENSMUSP00000006397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006397] [ENSMUST00000053583] [ENSMUST00000213181]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006397
AA Change: D59G

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006397
Gene: ENSMUSG00000006235
AA Change: D59G

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 37 139 9.1e-30 PFAM
FN3 144 227 2.48e-6 SMART
transmembrane domain 250 272 N/A INTRINSIC
low complexity region 434 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053583
SMART Domains Protein: ENSMUSP00000060331
Gene: ENSMUSG00000051238

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 40 52 N/A INTRINSIC
Blast:AAA 53 189 3e-34 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000213181
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the erythropoietin receptor which is a member of the cytokine receptor family. Upon erythropoietin binding, this receptor activates Jak2 tyrosine kinase which activates different intracellular pathways including: Ras/MAP kinase, phosphatidylinositol 3-kinase and STAT transcription factors. The stimulated erythropoietin receptor appears to have a role in erythroid cell survival. Defects in the erythropoietin receptor may produce erythroleukemia and familial erythrocytosis. Dysregulation of this gene may affect the growth of certain tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this locus affect erythropoiesis. Targeted null mutants die at embryonic day 11-12.5 with severe anemia. Mutants with truncated alleles are viable with mild changes in erythropoiesis. A human mutation replacement allele produces polycythemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,258,098 L2411R probably damaging Het
Als2 A G 1: 59,206,587 W577R probably damaging Het
Aox2 C A 1: 58,307,359 R551S probably benign Het
Areg A T 5: 91,146,718 H245L possibly damaging Het
Arhgap35 T C 7: 16,563,467 T558A possibly damaging Het
Arhgef28 A T 13: 97,936,860 C1322* probably null Het
Arhgef38 T C 3: 133,206,958 R107G possibly damaging Het
Atf7ip T A 6: 136,571,502 F695L probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Bche T G 3: 73,648,678 Q549P possibly damaging Het
Blnk A G 19: 40,929,289 F417L possibly damaging Het
Bloc1s1 T G 10: 128,923,386 K17T probably damaging Het
C330018D20Rik G T 18: 56,957,896 T65K probably damaging Het
Cers1 T A 8: 70,321,578 S162T possibly damaging Het
Cgn T C 3: 94,779,522 K157E probably benign Het
Cldn7 G A 11: 69,967,668 R196Q probably benign Het
Clrn2 C A 5: 45,454,027 Q73K probably benign Het
Cmss1 A G 16: 57,302,245 V262A probably benign Het
Cpb2 T A 14: 75,260,688 V97E probably damaging Het
Ctnnd2 G A 15: 30,683,241 V463I probably benign Het
Cyp7a1 A T 4: 6,268,476 S416R probably benign Het
Dip2b C T 15: 100,190,079 R965C probably damaging Het
Dkk3 T C 7: 112,150,658 T102A probably benign Het
Dmap1 C A 4: 117,680,842 probably null Het
Dnah12 C A 14: 26,886,871 D3872E possibly damaging Het
Dnah7b A G 1: 46,119,398 probably null Het
Dnaic1 C T 4: 41,632,391 T575I probably benign Het
Dsg1a T A 18: 20,331,542 Y365N probably damaging Het
Dusp11 T A 6: 85,959,233 K18* probably null Het
E2f2 A T 4: 136,172,934 T52S probably benign Het
Elavl4 A G 4: 110,290,644 L13S probably benign Het
Eral1 A G 11: 78,080,233 C43R possibly damaging Het
Fam135b A G 15: 71,490,848 V228A probably benign Het
Gba T C 3: 89,205,822 S187P probably damaging Het
Gcc2 G T 10: 58,255,847 probably benign Het
Gdap2 C A 3: 100,202,256 probably benign Het
Gm10271 A T 10: 116,972,592 F6L probably damaging Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gm8251 A T 1: 44,057,257 N1560K probably benign Het
Gpr160 T C 3: 30,896,463 L228P probably benign Het
Gsdmc2 A C 15: 63,830,866 V184G probably benign Het
Gtf2e2 A T 8: 33,776,052 K252M probably damaging Het
Gtf2e2 G T 8: 33,776,053 K252N probably benign Het
Gys1 T C 7: 45,438,105 Y102H probably benign Het
Hist1h4b A G 13: 23,757,226 D69G probably damaging Het
Ifit3b A C 19: 34,612,198 D258A probably damaging Het
Itpr3 T A 17: 27,104,601 M1200K probably damaging Het
Kcng4 A T 8: 119,626,359 F271I probably damaging Het
Klhdc2 C T 12: 69,303,613 S144L possibly damaging Het
Lhcgr A G 17: 88,755,578 F222S probably damaging Het
Lrp5 C G 19: 3,628,299 G519R probably damaging Het
Magel2 T C 7: 62,378,767 V473A probably benign Het
Map1a T C 2: 121,304,295 V1864A possibly damaging Het
Mast4 T A 13: 102,758,734 Q760H probably damaging Het
Mertk A G 2: 128,771,374 N437D probably benign Het
Mettl18 G A 1: 163,996,775 V222I probably benign Het
Mical2 C T 7: 112,334,948 T782M probably benign Het
Mocos T A 18: 24,686,693 V664E probably damaging Het
Neb G T 2: 52,295,294 N975K probably benign Het
Nectin3 A T 16: 46,464,145 S59T probably benign Het
Nelfb A T 2: 25,203,888 M11K probably damaging Het
Nrp1 A G 8: 128,476,169 N545S probably damaging Het
Olfr123 T A 17: 37,796,357 N304K probably benign Het
Olfr1333 T C 4: 118,830,281 D53G probably damaging Het
Olfr1472 A T 19: 13,453,960 S186T possibly damaging Het
Olfr492 T A 7: 108,323,047 T210S probably benign Het
Olfr66 T A 7: 103,881,700 D181V probably damaging Het
Olfr814 A T 10: 129,874,521 F79I probably damaging Het
Olfr968 T C 9: 39,772,540 T87A probably benign Het
P3h1 A G 4: 119,246,665 H587R probably damaging Het
Paqr4 A G 17: 23,739,858 probably null Het
Pde12 A G 14: 26,669,098 V152A probably benign Het
Ppip5k1 C A 2: 121,350,491 E45* probably null Het
Ptch2 C T 4: 117,110,057 A677V probably benign Het
Rgs12 A G 5: 35,020,345 N93S probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnf32 T C 5: 29,203,147 S125P probably damaging Het
Robo4 A G 9: 37,411,400 I850V probably damaging Het
Scap T A 9: 110,381,151 I876N probably damaging Het
Sin3a A G 9: 57,127,200 D1219G possibly damaging Het
Skint5 T C 4: 113,885,808 E354G unknown Het
Spg20 A G 3: 55,126,541 D396G probably benign Het
Spindoc G A 19: 7,373,659 S311L probably benign Het
Spta1 G T 1: 174,223,328 R1791L probably damaging Het
Tbck T C 3: 132,801,517 I750T possibly damaging Het
Tcrg-V1 A T 13: 19,340,304 Y66F probably benign Het
Tmem191c T C 16: 17,276,470 probably null Het
Vmn2r125 A G 4: 156,349,997 Y26C probably damaging Het
Zbtb17 T C 4: 141,464,817 C358R possibly damaging Het
Zfp180 G A 7: 24,105,434 G426E probably damaging Het
Zfp445 A G 9: 122,853,886 V330A probably benign Het
Zfp595 A G 13: 67,317,624 C192R probably damaging Het
Zkscan4 A G 13: 21,484,453 H387R probably damaging Het
Other mutations in Epor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Epor APN 9 21960591 missense possibly damaging 0.50
IGL01377:Epor APN 9 21959297 missense probably damaging 1.00
IGL01400:Epor APN 9 21959439 unclassified probably null
IGL01462:Epor APN 9 21959456 missense probably damaging 1.00
R1741:Epor UTSW 9 21959771 missense probably damaging 1.00
R1983:Epor UTSW 9 21959400 missense probably benign 0.00
R2414:Epor UTSW 9 21959489 missense probably damaging 1.00
R2655:Epor UTSW 9 21960720 missense probably damaging 1.00
R2879:Epor UTSW 9 21959640 missense probably damaging 1.00
R4598:Epor UTSW 9 21961859 missense probably benign 0.00
R4599:Epor UTSW 9 21961859 missense probably benign 0.00
R6462:Epor UTSW 9 21959255 missense probably benign 0.05
R7182:Epor UTSW 9 21963329 missense probably benign 0.01
R7413:Epor UTSW 9 21963480 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATTATTCCAGCTCCGGCCAC -3'
(R):5'- TTATCGGATCTGCACAGGC -3'

Sequencing Primer
(F):5'- GGCGACCTCCACACCATC -3'
(R):5'- TCTGCACAGGCGACAAG -3'
Posted On2017-06-26