Incidental Mutation 'R5987:Spart'
ID 481702
Institutional Source Beutler Lab
Gene Symbol Spart
Ensembl Gene ENSMUSG00000036580
Gene Name spartin
Synonyms TAHCCP1, Spg20
MMRRC Submission 044167-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.244) question?
Stock # R5987 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 55019529-55044743 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55033962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 396 (D396G)
Ref Sequence ENSEMBL: ENSMUSP00000113621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044116] [ENSMUST00000107971] [ENSMUST00000117341] [ENSMUST00000118118]
AlphaFold Q8R1X6
Predicted Effect probably benign
Transcript: ENSMUST00000044116
AA Change: D396G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042367
Gene: ENSMUSG00000036580
AA Change: D396G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 431 616 9.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107971
AA Change: D339G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103605
Gene: ENSMUSG00000036580
AA Change: D339G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 9e-4 SMART
low complexity region 351 369 N/A INTRINSIC
Pfam:Senescence 373 560 3.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117341
AA Change: D396G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113968
Gene: ENSMUSG00000036580
AA Change: D396G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 582 9.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118118
AA Change: D396G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113621
Gene: ENSMUSG00000036580
AA Change: D396G

DomainStartEndE-ValueType
MIT 16 94 4.64e-18 SMART
SCOP:d1bw0a_ 158 254 8e-4 SMART
low complexity region 369 381 N/A INTRINSIC
low complexity region 408 426 N/A INTRINSIC
Pfam:Senescence 430 617 3.8e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199416
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired lipid droplet amintenance, cytokinesis and impaired motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A C 1: 71,297,257 (GRCm39) L2411R probably damaging Het
Als2 A G 1: 59,245,746 (GRCm39) W577R probably damaging Het
Aox1 C A 1: 58,346,518 (GRCm39) R551S probably benign Het
Areg A T 5: 91,294,577 (GRCm39) H245L possibly damaging Het
Arhgap35 T C 7: 16,297,392 (GRCm39) T558A possibly damaging Het
Arhgef28 A T 13: 98,073,368 (GRCm39) C1322* probably null Het
Arhgef38 T C 3: 132,912,719 (GRCm39) R107G possibly damaging Het
Atf7ip T A 6: 136,548,500 (GRCm39) F695L probably damaging Het
AW209491 C T 13: 14,812,365 (GRCm39) A406V probably benign Het
Bche T G 3: 73,556,011 (GRCm39) Q549P possibly damaging Het
Blnk A G 19: 40,917,733 (GRCm39) F417L possibly damaging Het
Bloc1s1 T G 10: 128,759,255 (GRCm39) K17T probably damaging Het
C330018D20Rik G T 18: 57,090,968 (GRCm39) T65K probably damaging Het
Ccdc168 A T 1: 44,096,417 (GRCm39) N1560K probably benign Het
Cers1 T A 8: 70,774,228 (GRCm39) S162T possibly damaging Het
Cgn T C 3: 94,686,832 (GRCm39) K157E probably benign Het
Cldn7 G A 11: 69,858,494 (GRCm39) R196Q probably benign Het
Clrn2 C A 5: 45,611,369 (GRCm39) Q73K probably benign Het
Cmss1 A G 16: 57,122,608 (GRCm39) V262A probably benign Het
Cpb2 T A 14: 75,498,128 (GRCm39) V97E probably damaging Het
Ctnnd2 G A 15: 30,683,387 (GRCm39) V463I probably benign Het
Cyp7a1 A T 4: 6,268,476 (GRCm39) S416R probably benign Het
Dip2b C T 15: 100,087,960 (GRCm39) R965C probably damaging Het
Dkk3 T C 7: 111,749,865 (GRCm39) T102A probably benign Het
Dmap1 C A 4: 117,538,039 (GRCm39) probably null Het
Dnah12 C A 14: 26,608,828 (GRCm39) D3872E possibly damaging Het
Dnah7b A G 1: 46,158,558 (GRCm39) probably null Het
Dnai1 C T 4: 41,632,391 (GRCm39) T575I probably benign Het
Dsg1a T A 18: 20,464,599 (GRCm39) Y365N probably damaging Het
Dusp11 T A 6: 85,936,215 (GRCm39) K18* probably null Het
E2f2 A T 4: 135,900,245 (GRCm39) T52S probably benign Het
Elavl4 A G 4: 110,147,841 (GRCm39) L13S probably benign Het
Epor T C 9: 21,873,572 (GRCm39) D59G possibly damaging Het
Eral1 A G 11: 77,971,059 (GRCm39) C43R possibly damaging Het
Fam135b A G 15: 71,362,697 (GRCm39) V228A probably benign Het
Gba1 T C 3: 89,113,129 (GRCm39) S187P probably damaging Het
Gcc2 G T 10: 58,091,669 (GRCm39) probably benign Het
Gdap2 C A 3: 100,109,572 (GRCm39) probably benign Het
Gm10271 A T 10: 116,808,497 (GRCm39) F6L probably damaging Het
Gm10801 C CGTG 2: 98,494,152 (GRCm39) probably null Het
Gpr160 T C 3: 30,950,612 (GRCm39) L228P probably benign Het
Gsdmc2 A C 15: 63,702,715 (GRCm39) V184G probably benign Het
Gtf2e2 A T 8: 34,266,080 (GRCm39) K252M probably damaging Het
Gtf2e2 G T 8: 34,266,081 (GRCm39) K252N probably benign Het
Gys1 T C 7: 45,087,529 (GRCm39) Y102H probably benign Het
H4c2 A G 13: 23,941,209 (GRCm39) D69G probably damaging Het
Ifit3b A C 19: 34,589,598 (GRCm39) D258A probably damaging Het
Itpr3 T A 17: 27,323,575 (GRCm39) M1200K probably damaging Het
Kcng4 A T 8: 120,353,098 (GRCm39) F271I probably damaging Het
Klhdc2 C T 12: 69,350,387 (GRCm39) S144L possibly damaging Het
Lhcgr A G 17: 89,063,006 (GRCm39) F222S probably damaging Het
Lrp5 C G 19: 3,678,299 (GRCm39) G519R probably damaging Het
Magel2 T C 7: 62,028,515 (GRCm39) V473A probably benign Het
Map1a T C 2: 121,134,776 (GRCm39) V1864A possibly damaging Het
Mast4 T A 13: 102,895,242 (GRCm39) Q760H probably damaging Het
Mertk A G 2: 128,613,294 (GRCm39) N437D probably benign Het
Mettl18 G A 1: 163,824,344 (GRCm39) V222I probably benign Het
Mical2 C T 7: 111,934,155 (GRCm39) T782M probably benign Het
Mocos T A 18: 24,819,750 (GRCm39) V664E probably damaging Het
Neb G T 2: 52,185,306 (GRCm39) N975K probably benign Het
Nectin3 A T 16: 46,284,508 (GRCm39) S59T probably benign Het
Nelfb A T 2: 25,093,900 (GRCm39) M11K probably damaging Het
Nrp1 A G 8: 129,202,650 (GRCm39) N545S probably damaging Het
Or10ak11 T C 4: 118,687,478 (GRCm39) D53G probably damaging Het
Or2g1 T A 17: 38,107,248 (GRCm39) N304K probably benign Het
Or51b4 T A 7: 103,530,907 (GRCm39) D181V probably damaging Het
Or5b117 A T 19: 13,431,324 (GRCm39) S186T possibly damaging Het
Or5p67 T A 7: 107,922,254 (GRCm39) T210S probably benign Het
Or6c70 A T 10: 129,710,390 (GRCm39) F79I probably damaging Het
Or8g53 T C 9: 39,683,836 (GRCm39) T87A probably benign Het
P3h1 A G 4: 119,103,862 (GRCm39) H587R probably damaging Het
Paqr4 A G 17: 23,958,832 (GRCm39) probably null Het
Pde12 A G 14: 26,390,253 (GRCm39) V152A probably benign Het
Ppip5k1 C A 2: 121,180,972 (GRCm39) E45* probably null Het
Ptch2 C T 4: 116,967,254 (GRCm39) A677V probably benign Het
Rgs12 A G 5: 35,177,689 (GRCm39) N93S probably damaging Het
Rif1 C G 2: 51,985,856 (GRCm39) L614V probably damaging Het
Rnf32 T C 5: 29,408,145 (GRCm39) S125P probably damaging Het
Robo4 A G 9: 37,322,696 (GRCm39) I850V probably damaging Het
Scap T A 9: 110,210,219 (GRCm39) I876N probably damaging Het
Sin3a A G 9: 57,034,484 (GRCm39) D1219G possibly damaging Het
Skint5 T C 4: 113,743,005 (GRCm39) E354G unknown Het
Spindoc G A 19: 7,351,024 (GRCm39) S311L probably benign Het
Spta1 G T 1: 174,050,894 (GRCm39) R1791L probably damaging Het
Tbck T C 3: 132,507,278 (GRCm39) I750T possibly damaging Het
Tmem191 T C 16: 17,094,334 (GRCm39) probably null Het
Trgv1 A T 13: 19,524,474 (GRCm39) Y66F probably benign Het
Vmn2r125 A G 4: 156,702,292 (GRCm39) Y26C probably damaging Het
Zbtb17 T C 4: 141,192,128 (GRCm39) C358R possibly damaging Het
Zfp180 G A 7: 23,804,859 (GRCm39) G426E probably damaging Het
Zfp445 A G 9: 122,682,951 (GRCm39) V330A probably benign Het
Zfp595 A G 13: 67,465,688 (GRCm39) C192R probably damaging Het
Zkscan4 A G 13: 21,668,623 (GRCm39) H387R probably damaging Het
Other mutations in Spart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Spart APN 3 55,029,177 (GRCm39) missense probably damaging 1.00
IGL01539:Spart APN 3 55,024,723 (GRCm39) missense possibly damaging 0.95
IGL01982:Spart APN 3 55,035,911 (GRCm39) splice site probably null
IGL02345:Spart APN 3 55,025,147 (GRCm39) splice site probably null
IGL03217:Spart APN 3 55,035,912 (GRCm39) splice site probably benign
IGL03344:Spart APN 3 55,029,106 (GRCm39) missense probably benign 0.03
BB007:Spart UTSW 3 55,035,697 (GRCm39) missense probably damaging 1.00
BB017:Spart UTSW 3 55,035,697 (GRCm39) missense probably damaging 1.00
R0145:Spart UTSW 3 55,035,092 (GRCm39) nonsense probably null
R0522:Spart UTSW 3 55,035,786 (GRCm39) missense probably damaging 1.00
R1506:Spart UTSW 3 55,024,992 (GRCm39) missense probably damaging 0.99
R2043:Spart UTSW 3 55,034,969 (GRCm39) missense probably damaging 1.00
R2183:Spart UTSW 3 55,024,554 (GRCm39) missense probably benign 0.43
R4022:Spart UTSW 3 55,025,157 (GRCm39) missense probably damaging 1.00
R5154:Spart UTSW 3 55,024,750 (GRCm39) missense probably damaging 1.00
R5869:Spart UTSW 3 55,042,931 (GRCm39) missense probably benign 0.00
R6142:Spart UTSW 3 55,024,669 (GRCm39) missense probably damaging 1.00
R6185:Spart UTSW 3 55,024,640 (GRCm39) missense probably damaging 1.00
R6652:Spart UTSW 3 55,032,248 (GRCm39) missense probably benign 0.00
R6791:Spart UTSW 3 55,034,982 (GRCm39) missense probably damaging 1.00
R7131:Spart UTSW 3 55,029,220 (GRCm39) critical splice donor site probably null
R7930:Spart UTSW 3 55,035,697 (GRCm39) missense probably damaging 1.00
R8005:Spart UTSW 3 55,024,773 (GRCm39) missense probably benign 0.00
R8458:Spart UTSW 3 55,032,315 (GRCm39) missense probably damaging 1.00
R8734:Spart UTSW 3 55,032,300 (GRCm39) missense possibly damaging 0.92
R8791:Spart UTSW 3 55,029,100 (GRCm39) missense probably benign 0.19
R8929:Spart UTSW 3 55,035,979 (GRCm39) missense possibly damaging 0.96
R9060:Spart UTSW 3 55,032,275 (GRCm39) missense probably benign 0.02
R9172:Spart UTSW 3 55,032,267 (GRCm39) missense possibly damaging 0.68
R9539:Spart UTSW 3 55,034,924 (GRCm39) missense probably damaging 1.00
R9695:Spart UTSW 3 55,033,955 (GRCm39) missense probably benign
RF009:Spart UTSW 3 55,035,027 (GRCm39) missense probably benign 0.00
X0018:Spart UTSW 3 55,042,920 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGAGCTTGATTGTGACTCAG -3'
(R):5'- TGTCACTGGTTCAAGGTCTG -3'

Sequencing Primer
(F):5'- TGGAGTCACAGTTCTACTCAGAGC -3'
(R):5'- CACTGGTTCAAGGTCTGACACTG -3'
Posted On 2017-06-26