Incidental Mutation 'R6110:Fam151a'
ID484776
Institutional Source Beutler Lab
Gene Symbol Fam151a
Ensembl Gene ENSMUSG00000034871
Gene Namefamily with sequence simliarity 151, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6110 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106733889-106748292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106748198 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 586 (V586M)
Ref Sequence ENSEMBL: ENSMUSP00000047860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047620] [ENSMUST00000065253] [ENSMUST00000102762] [ENSMUST00000140541]
Predicted Effect probably damaging
Transcript: ENSMUST00000047620
AA Change: V586M

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047860
Gene: ENSMUSG00000034871
AA Change: V586M

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:DUF2181 70 310 2.9e-107 PFAM
Pfam:DUF2181 342 579 8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065253
SMART Domains Protein: ENSMUSP00000069636
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 84 157 7e-10 PFAM
Pfam:4HBT 255 331 2.6e-13 PFAM
START 405 603 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102762
SMART Domains Protein: ENSMUSP00000099823
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 64 136 7.2e-10 PFAM
Pfam:4HBT 235 311 6.7e-13 PFAM
START 385 583 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140541
SMART Domains Protein: ENSMUSP00000124567
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 32 71 3e-10 PDB
SCOP:d1lo7a_ 37 69 2e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b T C 4: 56,740,224 E378G probably damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Alkal2 G A 12: 30,887,058 R90Q probably damaging Het
Amy1 C T 3: 113,561,900 V309M probably damaging Het
Apob T C 12: 8,011,883 L3455P probably damaging Het
Ash1l T A 3: 88,985,129 H1438Q probably damaging Het
BC024139 A G 15: 76,119,796 S757P probably benign Het
Btd G A 14: 31,641,108 probably benign Het
C2cd3 T A 7: 100,441,076 F462Y probably damaging Het
C4bp T A 1: 130,639,072 K177* probably null Het
Cacna1h G T 17: 25,391,276 P752Q probably benign Het
Cd34 G A 1: 194,949,569 probably null Het
Clptm1 G A 7: 19,633,806 probably benign Het
Dip2c T C 13: 9,623,766 S1081P probably damaging Het
Dnm3 CAGCCTTCGTTGGGTG C 1: 162,011,068 probably benign Het
Efcab6 T G 15: 83,879,634 M1166L possibly damaging Het
Fap T G 2: 62,554,770 Y54S possibly damaging Het
Gm17727 A T 9: 35,777,146 S48T possibly damaging Het
Grhl1 A G 12: 24,580,747 probably null Het
Hcrtr2 T C 9: 76,259,782 Y91C probably damaging Het
Kat6b C T 14: 21,670,487 R1745C probably damaging Het
Kdm5a T C 6: 120,412,306 L898P probably damaging Het
Lipo5 T C 19: 33,467,917 Q84R unknown Het
Mfn1 G A 3: 32,563,024 M18I probably benign Het
Mptx2 G A 1: 173,274,847 L92F probably benign Het
Mtfmt T C 9: 65,447,304 probably null Het
Nsun2 C G 13: 69,627,648 Q404E probably benign Het
Odf3 G T 7: 140,848,641 R73L possibly damaging Het
Olfr1052 T A 2: 86,298,675 N286K probably damaging Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Olfr346 T C 2: 36,688,547 S182P probably benign Het
Olfr495 G T 7: 108,395,828 S236I possibly damaging Het
Olfr520 C T 7: 99,735,170 S9L possibly damaging Het
Olfr646 A G 7: 104,106,572 M98V probably damaging Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Parp9 A G 16: 35,953,626 I90V possibly damaging Het
Pax2 T A 19: 44,790,736 S183T probably damaging Het
Pcdha11 T C 18: 37,011,456 L200P probably damaging Het
Pcdhb4 T C 18: 37,308,429 V264A possibly damaging Het
Plch1 G T 3: 63,698,858 N1199K possibly damaging Het
Ptpn22 A G 3: 103,912,015 N795S probably damaging Het
Qars T C 9: 108,508,098 S6P probably benign Het
Sema3a T C 5: 13,581,001 Y502H probably damaging Het
Sema4f A G 6: 82,937,104 I91T probably damaging Het
Setx T G 2: 29,140,290 I247S probably damaging Het
Slc9c1 T C 16: 45,575,368 L594P probably damaging Het
Tnfrsf19 A T 14: 60,971,139 M311K probably benign Het
Ttc30b T C 2: 75,937,800 Y203C probably damaging Het
Tubgcp4 T C 2: 121,194,108 I588T probably benign Het
Tyro3 T C 2: 119,812,823 V655A probably damaging Het
Uba7 T A 9: 107,978,939 D504E probably benign Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Vldlr A G 19: 27,238,077 E117G possibly damaging Het
Vmn2r44 A T 7: 8,378,006 I296K probably damaging Het
Vmn2r80 T A 10: 79,182,003 C521S probably damaging Het
Wnk1 A T 6: 119,972,997 probably benign Het
Xpo1 T C 11: 23,287,434 S766P probably damaging Het
Zcchc4 A G 5: 52,796,144 N165S possibly damaging Het
Other mutations in Fam151a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Fam151a APN 4 106747593 missense possibly damaging 0.56
IGL02095:Fam151a APN 4 106747875 missense probably damaging 1.00
IGL02170:Fam151a APN 4 106735598 critical splice donor site probably null
IGL02725:Fam151a APN 4 106748014 missense probably damaging 0.99
R0025:Fam151a UTSW 4 106748174 missense probably benign 0.16
R0114:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R0620:Fam151a UTSW 4 106747931 missense probably benign 0.06
R1345:Fam151a UTSW 4 106742294 missense probably damaging 0.99
R1482:Fam151a UTSW 4 106745679 missense probably damaging 1.00
R1965:Fam151a UTSW 4 106733915 unclassified probably benign
R2086:Fam151a UTSW 4 106735563 splice site probably null
R4078:Fam151a UTSW 4 106747757 missense probably benign 0.31
R4677:Fam151a UTSW 4 106748259 missense possibly damaging 0.72
R6188:Fam151a UTSW 4 106745499 missense possibly damaging 0.61
R6288:Fam151a UTSW 4 106748144 missense probably damaging 0.99
R6526:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R7298:Fam151a UTSW 4 106735528 missense possibly damaging 0.80
R7341:Fam151a UTSW 4 106735510 missense probably benign 0.00
R7363:Fam151a UTSW 4 106745484 missense probably damaging 1.00
R7573:Fam151a UTSW 4 106743305 missense probably damaging 1.00
R8368:Fam151a UTSW 4 106746993 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGTCAGAGTCCAGCCAAC -3'
(R):5'- CAACACTTTCAAGGCTTGTGAGAG -3'

Sequencing Primer
(F):5'- AGAGTCCAGCCAACACTGTGG -3'
(R):5'- TTTCTGTTGGACAACCGGAATGAC -3'
Posted On2017-08-16