Incidental Mutation 'R6188:Fam151a'
ID502305
Institutional Source Beutler Lab
Gene Symbol Fam151a
Ensembl Gene ENSMUSG00000034871
Gene Namefamily with sequence simliarity 151, member A
Synonyms
MMRRC Submission 044328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6188 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106733889-106748292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106745499 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 205 (Y205F)
Ref Sequence ENSEMBL: ENSMUSP00000047860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047620] [ENSMUST00000065253] [ENSMUST00000102762] [ENSMUST00000140541]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047620
AA Change: Y205F

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047860
Gene: ENSMUSG00000034871
AA Change: Y205F

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:DUF2181 70 310 2.9e-107 PFAM
Pfam:DUF2181 342 579 8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065253
SMART Domains Protein: ENSMUSP00000069636
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 84 157 7e-10 PFAM
Pfam:4HBT 255 331 2.6e-13 PFAM
START 405 603 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102762
SMART Domains Protein: ENSMUSP00000099823
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 64 136 7.2e-10 PFAM
Pfam:4HBT 235 311 6.7e-13 PFAM
START 385 583 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140541
SMART Domains Protein: ENSMUSP00000124567
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 32 71 3e-10 PDB
SCOP:d1lo7a_ 37 69 2e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,183,731 I88F possibly damaging Het
4930407I10Rik T C 15: 82,059,270 S28P probably benign Het
4930504O13Rik T C 11: 58,446,356 E97G probably benign Het
4931408C20Rik T A 1: 26,685,703 Y132F probably damaging Het
4932415D10Rik A G 10: 82,285,257 I3973T probably damaging Het
a A T 2: 155,047,682 N56I probably damaging Het
Apoe C A 7: 19,698,380 probably benign Het
Aspm C A 1: 139,479,239 R1955S possibly damaging Het
Boc G A 16: 44,499,548 L358F possibly damaging Het
Cadm2 A T 16: 66,815,307 probably null Het
Ccdc183 T C 2: 25,609,752 E384G probably benign Het
Ccl12 A G 11: 82,103,117 T67A probably damaging Het
Cep120 T C 18: 53,724,457 D312G probably benign Het
Cmya5 A G 13: 93,093,444 V1712A possibly damaging Het
Cmya5 A G 13: 93,097,276 S435P possibly damaging Het
Dmbt1 A T 7: 131,097,631 N997Y probably damaging Het
Dock2 T A 11: 34,503,396 I86F probably damaging Het
Duox1 A G 2: 122,319,794 Q168R probably benign Het
Epb41l4a T A 18: 33,832,665 I370L probably benign Het
Erc2 T A 14: 28,317,251 D950E probably damaging Het
Exoc6b A G 6: 84,855,497 V405A probably damaging Het
F13a1 T C 13: 37,025,778 D71G probably benign Het
Fcnb C A 2: 28,079,190 R165M possibly damaging Het
Fndc3a C T 14: 72,589,961 V50I probably damaging Het
Gm13276 C T 4: 88,785,859 Q51* probably null Het
Grik1 T C 16: 88,056,071 T75A probably benign Het
Grip2 A G 6: 91,763,533 L1015P probably damaging Het
Hnrnpk A G 13: 58,394,153 F339L probably benign Het
Iqgap3 A G 3: 88,098,893 D537G probably benign Het
Kars C T 8: 112,008,481 probably null Het
Kpna7 G T 5: 144,992,844 N390K probably damaging Het
Krt36 A T 11: 100,102,420 S410T probably benign Het
Lingo4 A G 3: 94,402,850 E365G probably damaging Het
Liph T C 16: 21,984,268 D17G probably benign Het
Lmbrd1 C A 1: 24,711,545 N166K probably benign Het
Nup155 T C 15: 8,109,575 S44P probably damaging Het
Olfr1245 A T 2: 89,575,194 C177* probably null Het
Olfr1441 A G 19: 12,422,610 I100M probably benign Het
Olfr164 A G 16: 19,286,557 M62T probably damaging Het
Pcdhga6 T C 18: 37,708,271 V348A probably benign Het
Phc3 G A 3: 30,937,049 Q295* probably null Het
Phyh A G 2: 4,927,490 E129G probably damaging Het
Polb A G 8: 22,647,447 S96P probably damaging Het
Ppp1r9a A T 6: 5,158,113 K1174* probably null Het
Ppp1r9b C T 11: 94,991,836 R97W probably damaging Het
Pttg1ip T C 10: 77,582,508 probably null Het
Pygm G A 19: 6,397,937 probably null Het
Rgs20 GGAGAGAG GGAGAG 1: 5,020,883 probably null Het
Rlf T C 4: 121,170,766 H111R probably damaging Het
Rmdn3 A G 2: 119,139,350 probably null Het
Ror2 T A 13: 53,111,311 T570S probably damaging Het
Sel1l3 A C 5: 53,155,719 I542R possibly damaging Het
Serpinb3d A G 1: 107,078,507 F284L probably damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A G 15: 96,692,516 probably null Het
Tet2 T C 3: 133,480,326 S1117G probably benign Het
Trav15-1-dv6-1 C T 14: 53,559,957 A21V probably damaging Het
Tsr3 G T 17: 25,241,861 D234Y probably null Het
Vmn1r220 A T 13: 23,183,914 L204H probably damaging Het
Vmn1r3 A T 4: 3,185,017 S97T probably damaging Het
Zfp599 A G 9: 22,249,990 F293S probably damaging Het
Zfp983 A G 17: 21,659,019 Y46C probably damaging Het
Other mutations in Fam151a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Fam151a APN 4 106747593 missense possibly damaging 0.56
IGL02095:Fam151a APN 4 106747875 missense probably damaging 1.00
IGL02170:Fam151a APN 4 106735598 critical splice donor site probably null
IGL02725:Fam151a APN 4 106748014 missense probably damaging 0.99
R0025:Fam151a UTSW 4 106748174 missense probably benign 0.16
R0114:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R0620:Fam151a UTSW 4 106747931 missense probably benign 0.06
R1345:Fam151a UTSW 4 106742294 missense probably damaging 0.99
R1482:Fam151a UTSW 4 106745679 missense probably damaging 1.00
R1965:Fam151a UTSW 4 106733915 unclassified probably benign
R2086:Fam151a UTSW 4 106735563 splice site probably null
R4078:Fam151a UTSW 4 106747757 missense probably benign 0.31
R4677:Fam151a UTSW 4 106748259 missense possibly damaging 0.72
R6110:Fam151a UTSW 4 106748198 missense probably damaging 0.98
R6288:Fam151a UTSW 4 106748144 missense probably damaging 0.99
R6526:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R7298:Fam151a UTSW 4 106735528 missense possibly damaging 0.80
R7341:Fam151a UTSW 4 106735510 missense probably benign 0.00
R7363:Fam151a UTSW 4 106745484 missense probably damaging 1.00
R7573:Fam151a UTSW 4 106743305 missense probably damaging 1.00
R8368:Fam151a UTSW 4 106746993 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GACTGCACAGGGTGGTGATATC -3'
(R):5'- CACCTCTCAGATTGGCTCAGAAG -3'

Sequencing Primer
(F):5'- TATCAGCAGGAGGATGTACAAATCAC -3'
(R):5'- CTCAGAAGCCAGCTGAAGTG -3'
Posted On2018-02-27