Incidental Mutation 'R7298:Fam151a'
ID566791
Institutional Source Beutler Lab
Gene Symbol Fam151a
Ensembl Gene ENSMUSG00000034871
Gene Namefamily with sequence simliarity 151, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7298 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106733889-106748292 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106735528 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 69 (R69L)
Ref Sequence ENSEMBL: ENSMUSP00000047860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047620] [ENSMUST00000148281]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047620
AA Change: R69L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047860
Gene: ENSMUSG00000034871
AA Change: R69L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:DUF2181 70 310 2.9e-107 PFAM
Pfam:DUF2181 342 579 8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148281
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,207,883 T51S probably benign Het
Abcc1 A G 16: 14,396,472 D204G possibly damaging Het
Acaa1b C T 9: 119,151,847 E172K probably benign Het
Adamts5 G A 16: 85,899,918 T117I probably benign Het
Agmat A G 4: 141,746,964 E52G possibly damaging Het
Alg9 C T 9: 50,779,061 A121V probably damaging Het
Atf7ip2 T C 16: 10,209,168 I100T possibly damaging Het
Calm2 T C 17: 87,442,737 probably null Het
Cfap44 A T 16: 44,481,412 M1838L probably benign Het
Cym A G 3: 107,219,693 Y49H probably benign Het
Dchs1 G A 7: 105,755,131 R2735* probably null Het
Dnajc6 T C 4: 101,606,611 I187T probably benign Het
Gm13089 C A 4: 143,698,505 D123Y probably benign Het
Gm14548 T A 7: 3,895,265 I353F possibly damaging Het
Gm4779 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG X: 101,794,171 probably benign Het
Gm9922 C A 14: 101,729,525 G97V unknown Het
Hacl1 A T 14: 31,616,486 M378K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-82 A T 12: 115,952,954 I6N possibly damaging Het
Kctd19 A C 8: 105,382,984 V942G probably benign Het
Lce1l C T 3: 92,850,176 C125Y unknown Het
Mmp8 T C 9: 7,560,448 F42S probably damaging Het
Myom2 T C 8: 15,098,411 L529P probably damaging Het
Nectin3 A T 16: 46,448,396 Y548N probably damaging Het
Olfml3 T C 3: 103,735,860 K402E probably damaging Het
Olfr1255 T C 2: 89,816,521 F59S probably damaging Het
Olfr303 T A 7: 86,394,923 T192S probably damaging Het
Otof T A 5: 30,388,270 I514F probably damaging Het
Plch1 G T 3: 63,716,037 S603* probably null Het
Ppa1 T A 10: 61,666,912 D171E probably benign Het
Prss34 T C 17: 25,299,763 C240R probably damaging Het
Ptpre A G 7: 135,683,287 D714G probably damaging Het
Ranbp9 A G 13: 43,480,460 F157L probably benign Het
Rbbp6 A G 7: 123,001,194 K1475E unknown Het
Retnlg A G 16: 48,872,874 N5D probably benign Het
Rev1 T C 1: 38,053,104 T1245A probably damaging Het
Rngtt G T 4: 33,362,927 L360F probably damaging Het
Scrib A C 15: 76,064,761 V447G probably damaging Het
Slc22a6 C A 19: 8,621,320 A247E possibly damaging Het
Slc25a20 G A 9: 108,662,144 probably benign Het
Spag16 T A 1: 69,919,426 probably null Het
Stx3 C T 19: 11,790,048 W87* probably null Het
Syngap1 T A 17: 26,962,987 M1158K possibly damaging Het
Tmed9 C A 13: 55,593,294 H41N possibly damaging Het
Trav15-2-dv6-2 G A 14: 53,649,785 S54N probably benign Het
Tyk2 C T 9: 21,108,860 V1001I probably benign Het
Ugt8a A G 3: 125,915,416 V15A probably benign Het
Uhrf2 A G 19: 30,088,549 E661G probably benign Het
Vmn2r77 T A 7: 86,800,771 I75N probably benign Het
Zfp346 T G 13: 55,130,603 V258G probably damaging Het
Zfp72 T A 13: 74,372,394 K188N possibly damaging Het
Zgrf1 C A 3: 127,583,650 S848* probably null Het
Other mutations in Fam151a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Fam151a APN 4 106747593 missense possibly damaging 0.56
IGL02095:Fam151a APN 4 106747875 missense probably damaging 1.00
IGL02170:Fam151a APN 4 106735598 critical splice donor site probably null
IGL02725:Fam151a APN 4 106748014 missense probably damaging 0.99
R0025:Fam151a UTSW 4 106748174 missense probably benign 0.16
R0114:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R0620:Fam151a UTSW 4 106747931 missense probably benign 0.06
R1345:Fam151a UTSW 4 106742294 missense probably damaging 0.99
R1482:Fam151a UTSW 4 106745679 missense probably damaging 1.00
R1965:Fam151a UTSW 4 106733915 unclassified probably benign
R2086:Fam151a UTSW 4 106735563 unclassified probably null
R4078:Fam151a UTSW 4 106747757 missense probably benign 0.31
R4677:Fam151a UTSW 4 106748259 missense possibly damaging 0.72
R6110:Fam151a UTSW 4 106748198 missense probably damaging 0.98
R6188:Fam151a UTSW 4 106745499 missense possibly damaging 0.61
R6288:Fam151a UTSW 4 106748144 missense probably damaging 0.99
R6526:Fam151a UTSW 4 106734004 missense possibly damaging 0.63
R7341:Fam151a UTSW 4 106735510 missense probably benign 0.00
R7363:Fam151a UTSW 4 106745484 missense probably damaging 1.00
R7573:Fam151a UTSW 4 106743305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTTACCATACCAGGGGCTG -3'
(R):5'- TGACAGCTCTGTTCCCTCAG -3'

Sequencing Primer
(F):5'- ATACCAGGGGCTGTGGGTC -3'
(R):5'- CAGGGAGACTGTGGCAGGTATATG -3'
Posted On2019-06-26