Incidental Mutation 'R6123:Slitrk3'
ID485813
Institutional Source Beutler Lab
Gene Symbol Slitrk3
Ensembl Gene ENSMUSG00000048304
Gene NameSLIT and NTRK-like family, member 3
Synonyms
MMRRC Submission 044270-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.694) question?
Stock #R6123 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location73047265-73057803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73049762 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 559 (D559G)
Ref Sequence ENSEMBL: ENSMUSP00000141236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]
Predicted Effect probably damaging
Transcript: ENSMUST00000059407
AA Change: D559G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: D559G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000192477
AA Change: D559G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: D559G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Blast:LRRNT 44 79 3e-11 BLAST
LRR 101 124 2.08e1 SMART
LRR 125 148 6.05e0 SMART
LRR 149 172 3.97e0 SMART
LRR_TYP 173 196 1.67e-2 SMART
LRR 197 220 2.69e2 SMART
LRRCT 233 283 4.56e-5 SMART
low complexity region 332 350 N/A INTRINSIC
LRRNT 373 411 4.17e0 SMART
LRR 432 455 1.62e0 SMART
LRR_TYP 456 479 2.61e-4 SMART
LRR 480 503 2.82e0 SMART
LRR_TYP 504 527 6.99e-5 SMART
LRRCT 563 613 3.22e-5 SMART
transmembrane domain 658 680 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 836 843 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 870 888 N/A INTRINSIC
Blast:LRRCT 906 943 2e-16 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931423N10Rik T C 2: 23,230,122 Y235H possibly damaging Het
Acot7 A G 4: 152,199,945 E24G probably benign Het
Ankrd34b A G 13: 92,439,076 E272G probably damaging Het
Arhgef18 A T 8: 3,437,091 N270I probably damaging Het
AU040320 A G 4: 126,869,386 probably benign Het
BC022687 T C 12: 112,810,910 F153L probably damaging Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Ccdc146 C A 5: 21,305,597 R504I possibly damaging Het
Ckmt1 C G 2: 121,363,579 R408G probably benign Het
Cyp2j6 A T 4: 96,518,029 *502R probably null Het
Dido1 A T 2: 180,683,967 V476E probably benign Het
Dnah2 T C 11: 69,518,359 K398E probably benign Het
E130308A19Rik A G 4: 59,737,565 Y392C probably damaging Het
Esf1 T A 2: 140,168,389 D9V probably benign Het
Fam168a A G 7: 100,824,150 Q82R probably damaging Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Gm12394 A G 4: 42,793,065 S356P possibly damaging Het
Gm13084 A T 4: 143,812,764 M53K possibly damaging Het
Gm14496 T A 2: 181,991,227 M1K probably null Het
Gm6665 A G 18: 31,819,884 M79T probably benign Het
Gna15 A G 10: 81,509,344 L229P probably damaging Het
Herc1 A G 9: 66,497,250 T4451A probably damaging Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Ighv5-4 A T 12: 113,597,693 S36T probably damaging Het
Ints3 A G 3: 90,413,554 V186A probably benign Het
Jrk A G 15: 74,706,680 I252T possibly damaging Het
Kcnh5 T C 12: 75,087,591 S395G probably benign Het
Kcnt2 C T 1: 140,362,980 P103S probably damaging Het
Klra10 T C 6: 130,279,376 K105R probably benign Het
P4ha1 A T 10: 59,350,527 K276I possibly damaging Het
Pcyox1 A G 6: 86,388,928 S435P possibly damaging Het
R3hdm1 A T 1: 128,169,036 N103I probably damaging Het
Rnf213 T C 11: 119,411,513 V421A probably damaging Het
Rnpc3 A T 3: 113,609,056 probably null Het
Scaf11 A G 15: 96,420,454 S410P probably benign Het
Slc16a1 A G 3: 104,653,194 T272A probably benign Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Sntb2 G A 8: 106,981,225 G207D probably damaging Het
Spdye4a T C 5: 143,225,718 I30M possibly damaging Het
Thumpd1 A T 7: 119,717,009 V239E probably damaging Het
Tnfsf15 T C 4: 63,744,925 S54G probably benign Het
Tor1aip1 A G 1: 156,007,205 I299T probably damaging Het
Tpst2 C T 5: 112,308,218 R208C probably damaging Het
Tubgcp2 T C 7: 140,007,597 Y285C probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Washc5 A G 15: 59,335,110 S1105P probably damaging Het
Other mutations in Slitrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Slitrk3 APN 3 73051103 missense probably damaging 1.00
IGL00857:Slitrk3 APN 3 73049841 missense probably damaging 1.00
IGL00990:Slitrk3 APN 3 73050081 missense probably damaging 1.00
IGL01010:Slitrk3 APN 3 73049273 missense probably benign 0.14
IGL01299:Slitrk3 APN 3 73049016 missense probably benign 0.43
IGL01609:Slitrk3 APN 3 73050237 missense probably damaging 1.00
IGL01881:Slitrk3 APN 3 73049306 missense probably benign 0.00
IGL01941:Slitrk3 APN 3 73051071 missense possibly damaging 0.72
IGL02183:Slitrk3 APN 3 73049979 missense probably damaging 0.97
IGL02187:Slitrk3 APN 3 73050272 missense probably damaging 1.00
IGL02478:Slitrk3 APN 3 73050713 missense probably damaging 0.96
IGL02512:Slitrk3 APN 3 73050402 missense probably benign 0.28
IGL02720:Slitrk3 APN 3 73050768 missense probably damaging 1.00
IGL03113:Slitrk3 APN 3 73050390 missense probably benign 0.00
IGL03224:Slitrk3 APN 3 73049930 missense possibly damaging 0.72
wee UTSW 3 73050785 missense probably damaging 1.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0233:Slitrk3 UTSW 3 73048577 missense probably benign 0.00
R0639:Slitrk3 UTSW 3 73049649 missense probably benign 0.02
R1448:Slitrk3 UTSW 3 73050341 missense probably damaging 0.99
R1656:Slitrk3 UTSW 3 73050339 missense probably damaging 0.98
R1713:Slitrk3 UTSW 3 73049691 missense probably benign 0.00
R1992:Slitrk3 UTSW 3 73049771 missense possibly damaging 0.80
R1999:Slitrk3 UTSW 3 73049964 missense probably benign 0.13
R2359:Slitrk3 UTSW 3 73049345 missense possibly damaging 0.56
R3083:Slitrk3 UTSW 3 73048595 missense probably benign 0.00
R3153:Slitrk3 UTSW 3 73048982 nonsense probably null
R3821:Slitrk3 UTSW 3 73049216 missense possibly damaging 0.94
R4208:Slitrk3 UTSW 3 73051157 missense possibly damaging 0.67
R4323:Slitrk3 UTSW 3 73050785 missense probably damaging 1.00
R4580:Slitrk3 UTSW 3 73051206 missense probably damaging 0.96
R4730:Slitrk3 UTSW 3 73049519 missense probably benign 0.08
R4742:Slitrk3 UTSW 3 73048565 missense probably benign 0.00
R4979:Slitrk3 UTSW 3 73049796 missense possibly damaging 0.95
R5018:Slitrk3 UTSW 3 73050512 missense probably benign 0.31
R5023:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5057:Slitrk3 UTSW 3 73050648 missense probably benign 0.24
R5156:Slitrk3 UTSW 3 73049259 missense probably benign
R5500:Slitrk3 UTSW 3 73050347 missense probably damaging 1.00
R5582:Slitrk3 UTSW 3 73050404 missense probably benign 0.09
R5797:Slitrk3 UTSW 3 73048629 missense probably damaging 0.99
R5963:Slitrk3 UTSW 3 73050713 missense probably benign 0.30
R5985:Slitrk3 UTSW 3 73050900 missense probably damaging 1.00
R6393:Slitrk3 UTSW 3 73049914 missense possibly damaging 0.79
R6529:Slitrk3 UTSW 3 73051218 missense probably benign 0.02
R6584:Slitrk3 UTSW 3 73049225 missense probably damaging 0.99
R6645:Slitrk3 UTSW 3 73049861 missense probably benign 0.13
R7001:Slitrk3 UTSW 3 73050609 nonsense probably null
R7282:Slitrk3 UTSW 3 73050465 missense possibly damaging 0.70
R7534:Slitrk3 UTSW 3 73050107 missense probably damaging 0.98
R7577:Slitrk3 UTSW 3 73051115 missense probably damaging 0.99
R7757:Slitrk3 UTSW 3 73050839 missense probably damaging 1.00
X0022:Slitrk3 UTSW 3 73050266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAGGTTGGGCAATATGC -3'
(R):5'- TTCAACGTCATCCGGGAAATCC -3'

Sequencing Primer
(F):5'- AATATGCAGCATCTCTGGGC -3'
(R):5'- GTCATCCGGGAAATCCAACCTG -3'
Posted On2017-08-16