Mutagenetix > Incidental Mutations

Incidental Mutation 'R6123:Slitrk3'

485813

Institutional Source

Beutler Lab

Gene Symbol

Slitrk3

Ensembl Gene

ENSMUSG00000048304

Gene Name

SLIT and NTRK-like family, member 3

Synonyms

MMRRC Submission

044270-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.694) question?

Stock #

R6123 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73047265-73057803 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73049762 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 559 (D559G)

Ref Sequence

ENSEMBL: ENSMUSP00000141236 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059407
AA Change: D559G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: D559G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Blast:LRRNT	44	79	3e-11	BLAST
LRR	101	124	2.08e1	SMART
LRR	125	148	6.05e0	SMART
LRR	149	172	3.97e0	SMART
LRR_TYP	173	196	1.67e-2	SMART
LRR	197	220	2.69e2	SMART
LRRCT	233	283	4.56e-5	SMART
low complexity region	332	350	N/A	INTRINSIC
LRRNT	373	411	4.17e0	SMART
LRR	432	455	1.62e0	SMART
LRR_TYP	456	479	2.61e-4	SMART
LRR	480	503	2.82e0	SMART
LRR_TYP	504	527	6.99e-5	SMART
LRRCT	563	613	3.22e-5	SMART
transmembrane domain	658	680	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	836	843	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	870	888	N/A	INTRINSIC
Blast:LRRCT	906	943	2e-16	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000192477
AA Change: D559G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: D559G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Blast:LRRNT	44	79	3e-11	BLAST
LRR	101	124	2.08e1	SMART
LRR	125	148	6.05e0	SMART
LRR	149	172	3.97e0	SMART
LRR_TYP	173	196	1.67e-2	SMART
LRR	197	220	2.69e2	SMART
LRRCT	233	283	4.56e-5	SMART
low complexity region	332	350	N/A	INTRINSIC
LRRNT	373	411	4.17e0	SMART
LRR	432	455	1.62e0	SMART
LRR_TYP	456	479	2.61e-4	SMART
LRR	480	503	2.82e0	SMART
LRR_TYP	504	527	6.99e-5	SMART
LRRCT	563	613	3.22e-5	SMART
transmembrane domain	658	680	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	836	843	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	870	888	N/A	INTRINSIC
Blast:LRRCT	906	943	2e-16	BLAST

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	T	C	2: 23,230,122	Y235H	possibly damaging	Het
Acot7	A	G	4: 152,199,945	E24G	probably benign	Het
Ankrd34b	A	G	13: 92,439,076	E272G	probably damaging	Het
Arhgef18	A	T	8: 3,437,091	N270I	probably damaging	Het
AU040320	A	G	4: 126,869,386		probably benign	Het
BC022687	T	C	12: 112,810,910	F153L	probably damaging	Het
Btnl10	C	A	11: 58,920,304	S151Y	probably damaging	Het
Ccdc146	C	A	5: 21,305,597	R504I	possibly damaging	Het
Ckmt1	C	G	2: 121,363,579	R408G	probably benign	Het
Cyp2j6	A	T	4: 96,518,029	*502R	probably null	Het
Dido1	A	T	2: 180,683,967	V476E	probably benign	Het
Dnah2	T	C	11: 69,518,359	K398E	probably benign	Het
E130308A19Rik	A	G	4: 59,737,565	Y392C	probably damaging	Het
Esf1	T	A	2: 140,168,389	D9V	probably benign	Het
Fam168a	A	G	7: 100,824,150	Q82R	probably damaging	Het
Fastkd3	C	T	13: 68,590,218	Q32*	probably null	Het
Gm12394	A	G	4: 42,793,065	S356P	possibly damaging	Het
Gm13084	A	T	4: 143,812,764	M53K	possibly damaging	Het
Gm14496	T	A	2: 181,991,227	M1K	probably null	Het
Gm6665	A	G	18: 31,819,884	M79T	probably benign	Het
Gna15	A	G	10: 81,509,344	L229P	probably damaging	Het
Herc1	A	G	9: 66,497,250	T4451A	probably damaging	Het
Igf2bp1	A	G	11: 95,975,296	V122A	probably damaging	Het
Ighv5-4	A	T	12: 113,597,693	S36T	probably damaging	Het
Ints3	A	G	3: 90,413,554	V186A	probably benign	Het
Jrk	A	G	15: 74,706,680	I252T	possibly damaging	Het
Kcnh5	T	C	12: 75,087,591	S395G	probably benign	Het
Kcnt2	C	T	1: 140,362,980	P103S	probably damaging	Het
Klra10	T	C	6: 130,279,376	K105R	probably benign	Het
P4ha1	A	T	10: 59,350,527	K276I	possibly damaging	Het
Pcyox1	A	G	6: 86,388,928	S435P	possibly damaging	Het
R3hdm1	A	T	1: 128,169,036	N103I	probably damaging	Het
Rnf213	T	C	11: 119,411,513	V421A	probably damaging	Het
Rnpc3	A	T	3: 113,609,056		probably null	Het
Scaf11	A	G	15: 96,420,454	S410P	probably benign	Het
Slc16a1	A	G	3: 104,653,194	T272A	probably benign	Het
Slco3a1	C	T	7: 74,318,506	D489N	probably benign	Het
Sntb2	G	A	8: 106,981,225	G207D	probably damaging	Het
Spdye4a	T	C	5: 143,225,718	I30M	possibly damaging	Het
Thumpd1	A	T	7: 119,717,009	V239E	probably damaging	Het
Tnfsf15	T	C	4: 63,744,925	S54G	probably benign	Het
Tor1aip1	A	G	1: 156,007,205	I299T	probably damaging	Het
Tpst2	C	T	5: 112,308,218	R208C	probably damaging	Het
Tubgcp2	T	C	7: 140,007,597	Y285C	probably damaging	Het
Vav3	C	T	3: 109,664,365	T201M	probably damaging	Het
Washc5	A	G	15: 59,335,110	S1105P	probably damaging	Het

Other mutations in Slitrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Slitrk3	APN	3	73051103	missense	probably damaging	1.00
IGL00857:Slitrk3	APN	3	73049841	missense	probably damaging	1.00
IGL00990:Slitrk3	APN	3	73050081	missense	probably damaging	1.00
IGL01010:Slitrk3	APN	3	73049273	missense	probably benign	0.14
IGL01299:Slitrk3	APN	3	73049016	missense	probably benign	0.43
IGL01609:Slitrk3	APN	3	73050237	missense	probably damaging	1.00
IGL01881:Slitrk3	APN	3	73049306	missense	probably benign	0.00
IGL01941:Slitrk3	APN	3	73051071	missense	possibly damaging	0.72
IGL02183:Slitrk3	APN	3	73049979	missense	probably damaging	0.97
IGL02187:Slitrk3	APN	3	73050272	missense	probably damaging	1.00
IGL02478:Slitrk3	APN	3	73050713	missense	probably damaging	0.96
IGL02512:Slitrk3	APN	3	73050402	missense	probably benign	0.28
IGL02720:Slitrk3	APN	3	73050768	missense	probably damaging	1.00
IGL03113:Slitrk3	APN	3	73050390	missense	probably benign	0.00
IGL03224:Slitrk3	APN	3	73049930	missense	possibly damaging	0.72
wee	UTSW	3	73050785	missense	probably damaging	1.00
R0233:Slitrk3	UTSW	3	73048577	missense	probably benign	0.00
R0233:Slitrk3	UTSW	3	73048577	missense	probably benign	0.00
R0639:Slitrk3	UTSW	3	73049649	missense	probably benign	0.02
R1448:Slitrk3	UTSW	3	73050341	missense	probably damaging	0.99
R1656:Slitrk3	UTSW	3	73050339	missense	probably damaging	0.98
R1713:Slitrk3	UTSW	3	73049691	missense	probably benign	0.00
R1992:Slitrk3	UTSW	3	73049771	missense	possibly damaging	0.80
R1999:Slitrk3	UTSW	3	73049964	missense	probably benign	0.13
R2359:Slitrk3	UTSW	3	73049345	missense	possibly damaging	0.56
R3083:Slitrk3	UTSW	3	73048595	missense	probably benign	0.00
R3153:Slitrk3	UTSW	3	73048982	nonsense	probably null
R3821:Slitrk3	UTSW	3	73049216	missense	possibly damaging	0.94
R4208:Slitrk3	UTSW	3	73051157	missense	possibly damaging	0.67
R4323:Slitrk3	UTSW	3	73050785	missense	probably damaging	1.00
R4580:Slitrk3	UTSW	3	73051206	missense	probably damaging	0.96
R4730:Slitrk3	UTSW	3	73049519	missense	probably benign	0.08
R4742:Slitrk3	UTSW	3	73048565	missense	probably benign	0.00
R4979:Slitrk3	UTSW	3	73049796	missense	possibly damaging	0.95
R5018:Slitrk3	UTSW	3	73050512	missense	probably benign	0.31
R5023:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R5057:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R5156:Slitrk3	UTSW	3	73049259	missense	probably benign
R5500:Slitrk3	UTSW	3	73050347	missense	probably damaging	1.00
R5582:Slitrk3	UTSW	3	73050404	missense	probably benign	0.09
R5797:Slitrk3	UTSW	3	73048629	missense	probably damaging	0.99
R5963:Slitrk3	UTSW	3	73050713	missense	probably benign	0.30
R5985:Slitrk3	UTSW	3	73050900	missense	probably damaging	1.00
R6393:Slitrk3	UTSW	3	73049914	missense	possibly damaging	0.79
R6529:Slitrk3	UTSW	3	73051218	missense	probably benign	0.02
R6584:Slitrk3	UTSW	3	73049225	missense	probably damaging	0.99
R6645:Slitrk3	UTSW	3	73049861	missense	probably benign	0.13
R7001:Slitrk3	UTSW	3	73050609	nonsense	probably null
R7282:Slitrk3	UTSW	3	73050465	missense	possibly damaging	0.70
R7534:Slitrk3	UTSW	3	73050107	missense	probably damaging	0.98
R7577:Slitrk3	UTSW	3	73051115	missense	probably damaging	0.99
R7757:Slitrk3	UTSW	3	73050839	missense	probably damaging	1.00
X0022:Slitrk3	UTSW	3	73050266	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCAGGTTGGGCAATATGC -3'
(R):5'- TTCAACGTCATCCGGGAAATCC -3'

Sequencing Primer
(F):5'- AATATGCAGCATCTCTGGGC -3'
(R):5'- GTCATCCGGGAAATCCAACCTG -3'

Posted On

2017-08-16