Incidental Mutation 'R6032:Ppef2'
ID486320
Institutional Source Beutler Lab
Gene Symbol Ppef2
Ensembl Gene ENSMUSG00000029410
Gene Nameprotein phosphatase, EF hand calcium-binding domain 2
Synonyms
MMRRC Submission 044204-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6032 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92226679-92256278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92230524 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 604 (V604A)
Ref Sequence ENSEMBL: ENSMUSP00000144157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]
Predicted Effect probably benign
Transcript: ENSMUST00000031359
AA Change: V604A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410
AA Change: V604A

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201130
AA Change: V604A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410
AA Change: V604A

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201236
Meta Mutation Damage Score 0.1720 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
A2ml1 T A 6: 128,549,836 K1071* probably null Het
Abca13 G T 11: 9,297,752 V2500F possibly damaging Het
Adamdec1 T C 14: 68,579,184 E85G probably damaging Het
Aldh8a1 T C 10: 21,389,071 V199A probably benign Het
Aoc2 G A 11: 101,325,801 V237M probably damaging Het
Aplp2 C T 9: 31,150,944 R672H probably damaging Het
Apob A G 12: 7,995,513 N886S probably benign Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Atp6v1a T C 16: 44,106,940 Y328C probably damaging Het
Bag4 T C 8: 25,777,493 Y103C probably damaging Het
Crem C T 18: 3,267,673 R190Q probably damaging Het
Crybg1 A G 10: 43,956,760 S2000P probably damaging Het
Cubn T A 2: 13,325,184 T2629S probably benign Het
Cyhr1 C T 15: 76,658,858 R34Q probably damaging Het
Cyp3a44 G T 5: 145,777,946 S465Y probably damaging Het
Daam2 A C 17: 49,486,497 F331V probably damaging Het
Dnajc3 T C 14: 118,968,031 S146P possibly damaging Het
Dscam A G 16: 96,649,991 probably null Het
Fam184b G A 5: 45,582,896 S316L probably benign Het
Fat2 G C 11: 55,253,934 T4038S probably damaging Het
Fbxl19 C T 7: 127,761,265 R439C probably damaging Het
Gm3454 T A 15: 75,311,599 noncoding transcript Het
Gpatch3 A G 4: 133,578,306 E284G probably benign Het
Grm1 A T 10: 10,719,805 I693N probably damaging Het
Gsdme T A 6: 50,245,954 Q127L probably damaging Het
Ifnlr1 A G 4: 135,705,626 K458E probably benign Het
Kcns2 T C 15: 34,838,934 F148L probably benign Het
Lama1 A G 17: 67,750,643 T571A probably benign Het
Loxhd1 G A 18: 77,381,558 V108M probably damaging Het
Mef2c A T 13: 83,662,359 T375S probably benign Het
Ncor1 A T 11: 62,373,321 D144E possibly damaging Het
Nos3 A T 5: 24,379,811 T738S probably benign Het
Nrxn2 A T 19: 6,517,132 T1353S probably damaging Het
Olfr1289 T C 2: 111,483,850 L140P probably damaging Het
Olfr146 A G 9: 39,018,965 I192T probably benign Het
Olfr1535 G T 13: 21,555,907 S38R probably benign Het
Pfpl A G 19: 12,429,383 T333A probably damaging Het
Postn A T 3: 54,376,716 I565F possibly damaging Het
Pramef12 A C 4: 144,393,028 I323S possibly damaging Het
Prmt1 A G 7: 44,977,102 probably null Het
Rel A G 11: 23,742,684 S450P probably benign Het
Rpap2 A C 5: 107,597,795 D3A probably damaging Het
Shisa9 T C 16: 11,984,908 F110L possibly damaging Het
Slc25a10 A T 11: 120,494,958 probably null Het
Slx4 A T 16: 3,980,157 F1454L probably damaging Het
Smc1b A T 15: 85,066,229 V1198D possibly damaging Het
Supt5 T C 7: 28,316,175 Y879C probably damaging Het
Tbx15 T C 3: 99,352,517 M568T probably benign Het
Tle4 T C 19: 14,452,108 H698R possibly damaging Het
Trappc9 T C 15: 72,925,530 N803D probably benign Het
Trim10 A T 17: 36,871,714 R157S possibly damaging Het
Wsb1 T C 11: 79,240,199 probably benign Het
Zfp106 T C 2: 120,535,393 S178G probably benign Het
Other mutations in Ppef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ppef2 APN 5 92234237 missense probably damaging 1.00
IGL01105:Ppef2 APN 5 92249196 missense possibly damaging 0.91
IGL01613:Ppef2 APN 5 92235820 missense probably benign 0.01
IGL01793:Ppef2 APN 5 92246756 missense probably damaging 1.00
IGL02529:Ppef2 APN 5 92244737 missense probably damaging 1.00
IGL02702:Ppef2 APN 5 92231819 missense probably benign 0.01
IGL02992:Ppef2 APN 5 92235900 nonsense probably null
IGL02995:Ppef2 APN 5 92235900 nonsense probably null
IGL02996:Ppef2 APN 5 92235900 nonsense probably null
IGL03169:Ppef2 APN 5 92235900 nonsense probably null
IGL02991:Ppef2 UTSW 5 92235900 nonsense probably null
R0494:Ppef2 UTSW 5 92253093 splice site probably benign
R0659:Ppef2 UTSW 5 92230509 missense probably damaging 1.00
R0781:Ppef2 UTSW 5 92244830 missense probably benign 0.39
R1162:Ppef2 UTSW 5 92253121 missense probably benign 0.00
R1870:Ppef2 UTSW 5 92250512 missense probably damaging 1.00
R2212:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R2973:Ppef2 UTSW 5 92239094 missense probably benign
R3412:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3413:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3745:Ppef2 UTSW 5 92239151 splice site probably benign
R4878:Ppef2 UTSW 5 92228740 splice site probably null
R5027:Ppef2 UTSW 5 92234291 missense probably damaging 1.00
R5156:Ppef2 UTSW 5 92244602 critical splice donor site probably null
R5316:Ppef2 UTSW 5 92235811 missense probably benign 0.00
R5590:Ppef2 UTSW 5 92239139 missense probably damaging 0.99
R5773:Ppef2 UTSW 5 92250561 missense probably damaging 1.00
R5881:Ppef2 UTSW 5 92250529 nonsense probably null
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6182:Ppef2 UTSW 5 92227066 missense probably damaging 1.00
R6335:Ppef2 UTSW 5 92235754 missense probably damaging 1.00
R6645:Ppef2 UTSW 5 92230461 missense probably benign 0.02
R7448:Ppef2 UTSW 5 92228704 missense probably damaging 1.00
R7576:Ppef2 UTSW 5 92253134 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGGCCCTAAATAGCTGTTTCAG -3'
(R):5'- TGCCATGACCAACAAGAATAGTGG -3'

Sequencing Primer
(F):5'- GAATTTAGGCACCCCTTCATAGG -3'
(R):5'- GAATAGTGGTAACGGCCTTTATTCC -3'
Posted On2017-08-16