Mutagenetix > Incidental Mutations

Incidental Mutation 'R6032:Ppef2'

486320

Institutional Source

Beutler Lab

Gene Symbol

Ppef2

Ensembl Gene

ENSMUSG00000029410

Gene Name

protein phosphatase, EF hand calcium-binding domain 2

Synonyms

MMRRC Submission

044204-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6032 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92226679-92256278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92230524 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 604 (V604A)

Ref Sequence

ENSEMBL: ENSMUSP00000144157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]

Predicted Effect

probably benign
Transcript: ENSMUST00000031359
AA Change: V604A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410
AA Change: V604A

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000201130
AA Change: V604A

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410
AA Change: V604A

Domain	Start	End	E-Value	Type
IQ	18	40	3.48e-1	SMART
PP2Ac	141	544	1.97e-118	SMART
EFh	576	604	3.25e1	SMART
EFh	660	688	5.44e-3	SMART
EFh	700	728	1.67e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201236

Meta Mutation Damage Score

0.1720

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
A2ml1	T	A	6: 128,549,836	K1071*	probably null	Het
Abca13	G	T	11: 9,297,752	V2500F	possibly damaging	Het
Adamdec1	T	C	14: 68,579,184	E85G	probably damaging	Het
Aldh8a1	T	C	10: 21,389,071	V199A	probably benign	Het
Aoc2	G	A	11: 101,325,801	V237M	probably damaging	Het
Aplp2	C	T	9: 31,150,944	R672H	probably damaging	Het
Apob	A	G	12: 7,995,513	N886S	probably benign	Het
Ascc3	C	T	10: 50,842,183	R1991*	probably null	Het
Atp6v1a	T	C	16: 44,106,940	Y328C	probably damaging	Het
Bag4	T	C	8: 25,777,493	Y103C	probably damaging	Het
Crem	C	T	18: 3,267,673	R190Q	probably damaging	Het
Crybg1	A	G	10: 43,956,760	S2000P	probably damaging	Het
Cubn	T	A	2: 13,325,184	T2629S	probably benign	Het
Cyhr1	C	T	15: 76,658,858	R34Q	probably damaging	Het
Cyp3a44	G	T	5: 145,777,946	S465Y	probably damaging	Het
Daam2	A	C	17: 49,486,497	F331V	probably damaging	Het
Dnajc3	T	C	14: 118,968,031	S146P	possibly damaging	Het
Dscam	A	G	16: 96,649,991		probably null	Het
Fam184b	G	A	5: 45,582,896	S316L	probably benign	Het
Fat2	G	C	11: 55,253,934	T4038S	probably damaging	Het
Fbxl19	C	T	7: 127,761,265	R439C	probably damaging	Het
Gm3454	T	A	15: 75,311,599		noncoding transcript	Het
Gpatch3	A	G	4: 133,578,306	E284G	probably benign	Het
Grm1	A	T	10: 10,719,805	I693N	probably damaging	Het
Gsdme	T	A	6: 50,245,954	Q127L	probably damaging	Het
Ifnlr1	A	G	4: 135,705,626	K458E	probably benign	Het
Kcns2	T	C	15: 34,838,934	F148L	probably benign	Het
Lama1	A	G	17: 67,750,643	T571A	probably benign	Het
Loxhd1	G	A	18: 77,381,558	V108M	probably damaging	Het
Mef2c	A	T	13: 83,662,359	T375S	probably benign	Het
Ncor1	A	T	11: 62,373,321	D144E	possibly damaging	Het
Nos3	A	T	5: 24,379,811	T738S	probably benign	Het
Nrxn2	A	T	19: 6,517,132	T1353S	probably damaging	Het
Olfr1289	T	C	2: 111,483,850	L140P	probably damaging	Het
Olfr146	A	G	9: 39,018,965	I192T	probably benign	Het
Olfr1535	G	T	13: 21,555,907	S38R	probably benign	Het
Pfpl	A	G	19: 12,429,383	T333A	probably damaging	Het
Postn	A	T	3: 54,376,716	I565F	possibly damaging	Het
Pramef12	A	C	4: 144,393,028	I323S	possibly damaging	Het
Prmt1	A	G	7: 44,977,102		probably null	Het
Rel	A	G	11: 23,742,684	S450P	probably benign	Het
Rpap2	A	C	5: 107,597,795	D3A	probably damaging	Het
Shisa9	T	C	16: 11,984,908	F110L	possibly damaging	Het
Slc25a10	A	T	11: 120,494,958		probably null	Het
Slx4	A	T	16: 3,980,157	F1454L	probably damaging	Het
Smc1b	A	T	15: 85,066,229	V1198D	possibly damaging	Het
Supt5	T	C	7: 28,316,175	Y879C	probably damaging	Het
Tbx15	T	C	3: 99,352,517	M568T	probably benign	Het
Tle4	T	C	19: 14,452,108	H698R	possibly damaging	Het
Trappc9	T	C	15: 72,925,530	N803D	probably benign	Het
Trim10	A	T	17: 36,871,714	R157S	possibly damaging	Het
Wsb1	T	C	11: 79,240,199		probably benign	Het
Zfp106	T	C	2: 120,535,393	S178G	probably benign	Het

Other mutations in Ppef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Ppef2	APN	5	92234237	missense	probably damaging	1.00
IGL01105:Ppef2	APN	5	92249196	missense	possibly damaging	0.91
IGL01613:Ppef2	APN	5	92235820	missense	probably benign	0.01
IGL01793:Ppef2	APN	5	92246756	missense	probably damaging	1.00
IGL02529:Ppef2	APN	5	92244737	missense	probably damaging	1.00
IGL02702:Ppef2	APN	5	92231819	missense	probably benign	0.01
IGL02992:Ppef2	APN	5	92235900	nonsense	probably null
IGL02995:Ppef2	APN	5	92235900	nonsense	probably null
IGL02996:Ppef2	APN	5	92235900	nonsense	probably null
IGL03169:Ppef2	APN	5	92235900	nonsense	probably null
IGL02991:Ppef2	UTSW	5	92235900	nonsense	probably null
R0494:Ppef2	UTSW	5	92253093	splice site	probably benign
R0659:Ppef2	UTSW	5	92230509	missense	probably damaging	1.00
R0781:Ppef2	UTSW	5	92244830	missense	probably benign	0.39
R1162:Ppef2	UTSW	5	92253121	missense	probably benign	0.00
R1870:Ppef2	UTSW	5	92250512	missense	probably damaging	1.00
R2212:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R2973:Ppef2	UTSW	5	92239094	missense	probably benign
R3412:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R3413:Ppef2	UTSW	5	92228722	missense	probably damaging	0.97
R3745:Ppef2	UTSW	5	92239151	splice site	probably benign
R4878:Ppef2	UTSW	5	92228740	splice site	probably null
R5027:Ppef2	UTSW	5	92234291	missense	probably damaging	1.00
R5156:Ppef2	UTSW	5	92244602	critical splice donor site	probably null
R5316:Ppef2	UTSW	5	92235811	missense	probably benign	0.00
R5590:Ppef2	UTSW	5	92239139	missense	probably damaging	0.99
R5773:Ppef2	UTSW	5	92250561	missense	probably damaging	1.00
R5881:Ppef2	UTSW	5	92250529	nonsense	probably null
R6032:Ppef2	UTSW	5	92230524	missense	probably benign	0.23
R6182:Ppef2	UTSW	5	92227066	missense	probably damaging	1.00
R6335:Ppef2	UTSW	5	92235754	missense	probably damaging	1.00
R6645:Ppef2	UTSW	5	92230461	missense	probably benign	0.02
R7448:Ppef2	UTSW	5	92228704	missense	probably damaging	1.00
R7576:Ppef2	UTSW	5	92253134	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GGGCCCTAAATAGCTGTTTCAG -3'
(R):5'- TGCCATGACCAACAAGAATAGTGG -3'

Sequencing Primer
(F):5'- GAATTTAGGCACCCCTTCATAGG -3'
(R):5'- GAATAGTGGTAACGGCCTTTATTCC -3'

Posted On

2017-08-16