Incidental Mutation 'R6146:Lzts1'
ID488880
Institutional Source Beutler Lab
Gene Symbol Lzts1
Ensembl Gene ENSMUSG00000036306
Gene Nameleucine zipper, putative tumor suppressor 1
SynonymsFEZ1, F37
MMRRC Submission 044293-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6146 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location69132669-69184225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69140872 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 28 (S28P)
Ref Sequence ENSEMBL: ENSMUSP00000139117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037049] [ENSMUST00000185176]
Predicted Effect probably benign
Transcript: ENSMUST00000037049
AA Change: S28P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000039397
Gene: ENSMUSG00000036306
AA Change: S28P

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 305 350 N/A INTRINSIC
Pfam:Fez1 378 568 3.9e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185176
AA Change: S28P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139117
Gene: ENSMUSG00000036306
AA Change: S28P

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 305 350 N/A INTRINSIC
Pfam:Fez1 378 569 2.3e-79 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that is ubiquitously expressed in normal tissues. In uveal melanomas, expression of this protein is silenced in rapidly metastasizing and metastatic tumor cells but has normal expression in slowly metastasizing or nonmetastasizing tumor cells. This protein may have a role in cell-cycle control by interacting with the Cdk1/cyclinB1 complex. This gene is located on chromosomal region 8p22. Loss of heterozygosity (LOH) in the 8p arm is a common characteristic of many types of cancer. [provided by RefSeq, Nov 2009]
PHENOTYPE: Heterozygous or homozygous inactivation of this gene leads to increased incidence of spontaneous and carcinogen-induced tumors. Homozygtes for a null allele show working memory and cognitive deficits, enhanced anxiety, defects in glutamatergic synaptic transmission, and impaired spine maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,896,587 E29G probably benign Het
Abi3bp T C 16: 56,671,265 S552P probably damaging Het
Adgrg7 A G 16: 56,773,466 I129T probably benign Het
Adhfe1 A G 1: 9,553,718 N148S probably damaging Het
AI182371 A G 2: 35,097,971 Y77H probably damaging Het
Aldh5a1 C T 13: 24,919,678 probably null Het
Ankrd2 A G 19: 42,040,105 T67A possibly damaging Het
Anln A T 9: 22,376,308 C232* probably null Het
C330027C09Rik A T 16: 48,994,329 K18* probably null Het
Cchcr1 A G 17: 35,528,578 D587G possibly damaging Het
Cgn G T 3: 94,767,125 Q901K possibly damaging Het
Cluh G T 11: 74,667,228 probably null Het
Crebbp G A 16: 4,084,623 Q2213* probably null Het
Cyp2d22 T A 15: 82,373,835 probably null Het
Dcdc2a T C 13: 25,205,457 V456A probably benign Het
Depdc5 A G 5: 32,968,731 E569G probably benign Het
Dnah5 T C 15: 28,459,185 F4517L probably benign Het
Doc2b T C 11: 75,773,595 K317E probably damaging Het
Dysf T A 6: 84,203,199 D1951E probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
F2rl2 A C 13: 95,700,641 I65L probably benign Het
Fbxw17 A G 13: 50,432,512 K417E probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fxr2 A G 11: 69,641,339 M96V possibly damaging Het
Kcnj10 C A 1: 172,369,325 Y135* probably null Het
Kidins220 G A 12: 25,052,813 R1238Q probably damaging Het
Krt31 T C 11: 100,048,230 N255S probably benign Het
Lrp2 T C 2: 69,511,001 D945G probably benign Het
Lrrc66 T C 5: 73,608,089 D537G probably benign Het
Ltbp4 T A 7: 27,319,724 I992F probably damaging Het
Mrc2 C A 11: 105,325,644 N86K probably damaging Het
Mroh6 C A 15: 75,886,637 A302S possibly damaging Het
Muc16 T A 9: 18,497,797 N198Y probably damaging Het
Myo9a T C 9: 59,871,229 S1423P probably benign Het
Olfr1006 T A 2: 85,674,594 K186* probably null Het
Olfr1124 A T 2: 87,435,318 D277V possibly damaging Het
Olfr1141 A C 2: 87,753,258 L245R probably damaging Het
Olfr1367 A T 13: 21,346,994 Y22F possibly damaging Het
Olfr190 A G 16: 59,074,714 V122A probably benign Het
Olfr477 G T 7: 107,990,413 G16V probably damaging Het
Otogl G A 10: 107,777,117 silent Het
Polg T C 7: 79,450,512 M1184V probably benign Het
Prl8a8 T C 13: 27,510,480 Y108C probably damaging Het
Proser1 T A 3: 53,478,119 I474N probably damaging Het
Rab44 A G 17: 29,135,417 probably benign Het
Rbp1 C A 9: 98,425,616 D79E possibly damaging Het
Rnf213 T C 11: 119,435,999 V1605A probably benign Het
Rps24 A T 14: 24,490,735 probably null Het
Setd5 T C 6: 113,121,812 probably null Het
Slc38a3 T C 9: 107,655,029 I435V probably benign Het
Slco1a5 T A 6: 142,234,808 M623L probably benign Het
Spaca9 G A 2: 28,693,781 R64W probably damaging Het
Spn A G 7: 127,136,307 S343P possibly damaging Het
Sptan1 A G 2: 30,004,523 T1168A probably benign Het
Sptbn4 A T 7: 27,364,587 L2138* probably null Het
Tg T A 15: 66,673,367 probably null Het
Tigd5 T A 15: 75,910,245 L152Q probably damaging Het
Tmem163 C T 1: 127,519,389 V170I probably benign Het
Tpr T C 1: 150,423,162 C1068R possibly damaging Het
Ttc37 A G 13: 76,185,240 E1536G probably damaging Het
Ubr1 A T 2: 120,893,209 Y1290N probably damaging Het
Vmn1r184 T A 7: 26,267,392 F188I probably benign Het
Vmn2r100 G A 17: 19,522,260 V299I probably benign Het
Vmn2r91 T G 17: 18,136,256 H728Q probably benign Het
Vta1 T C 10: 14,705,352 Y37C probably damaging Het
Wbp2 C A 11: 116,083,902 M35I probably benign Het
Zcchc9 G A 13: 91,805,867 Q90* probably null Het
Other mutations in Lzts1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Lzts1 APN 8 69136092 missense probably benign 0.07
IGL01313:Lzts1 APN 8 69139107 missense probably benign 0.11
IGL02371:Lzts1 APN 8 69138798 missense probably damaging 0.99
IGL02508:Lzts1 APN 8 69140848 nonsense probably null
IGL03238:Lzts1 APN 8 69138794 missense probably damaging 1.00
R0645:Lzts1 UTSW 8 69135740 missense possibly damaging 0.92
R1442:Lzts1 UTSW 8 69138986 missense probably damaging 0.99
R1887:Lzts1 UTSW 8 69138833 missense probably damaging 1.00
R2366:Lzts1 UTSW 8 69140605 splice site probably null
R4238:Lzts1 UTSW 8 69135927 missense possibly damaging 0.61
R4489:Lzts1 UTSW 8 69135695 missense possibly damaging 0.94
R4508:Lzts1 UTSW 8 69135618 missense probably benign 0.00
R4965:Lzts1 UTSW 8 69138762 missense probably benign 0.44
R5159:Lzts1 UTSW 8 69138584 missense probably benign 0.44
R5643:Lzts1 UTSW 8 69139077 missense possibly damaging 0.94
R5644:Lzts1 UTSW 8 69139077 missense possibly damaging 0.94
R5782:Lzts1 UTSW 8 69140698 missense probably benign 0.00
R7069:Lzts1 UTSW 8 69140745 missense probably damaging 1.00
R7444:Lzts1 UTSW 8 69135679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCTACTCCGGTCTGACCCC -3'
(R):5'- TTTCCCAGGCTCTAAGAAGC -3'

Sequencing Primer
(F):5'- CCACTGGACAGGGCTGTGTAG -3'
(R):5'- CCCAGGCTCTAAGAAGCTTTTG -3'
Posted On2017-10-10