Mutagenetix > Incidental Mutations

Incidental Mutation 'R6146:Lzts1'

488880

Institutional Source

Beutler Lab

Gene Symbol

Lzts1

Ensembl Gene

ENSMUSG00000036306

Gene Name

leucine zipper, putative tumor suppressor 1

Synonyms

FEZ1, F37

MMRRC Submission

044293-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6146 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69132669-69184225 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69140872 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 28 (S28P)

Ref Sequence

ENSEMBL: ENSMUSP00000139117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037049] [ENSMUST00000185176]

Predicted Effect

probably benign
Transcript: ENSMUST00000037049
AA Change: S28P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000039397
Gene: ENSMUSG00000036306
AA Change: S28P

Domain	Start	End	E-Value	Type
low complexity region	50	62	N/A	INTRINSIC
low complexity region	305	350	N/A	INTRINSIC
Pfam:Fez1	378	568	3.9e-68	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000185176
AA Change: S28P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000139117
Gene: ENSMUSG00000036306
AA Change: S28P

Domain	Start	End	E-Value	Type
low complexity region	50	62	N/A	INTRINSIC
low complexity region	305	350	N/A	INTRINSIC
Pfam:Fez1	378	569	2.3e-79	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that is ubiquitously expressed in normal tissues. In uveal melanomas, expression of this protein is silenced in rapidly metastasizing and metastatic tumor cells but has normal expression in slowly metastasizing or nonmetastasizing tumor cells. This protein may have a role in cell-cycle control by interacting with the Cdk1/cyclinB1 complex. This gene is located on chromosomal region 8p22. Loss of heterozygosity (LOH) in the 8p arm is a common characteristic of many types of cancer. [provided by RefSeq, Nov 2009]
PHENOTYPE: Heterozygous or homozygous inactivation of this gene leads to increased incidence of spontaneous and carcinogen-induced tumors. Homozygtes for a null allele show working memory and cognitive deficits, enhanced anxiety, defects in glutamatergic synaptic transmission, and impaired spine maturation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	G	5: 8,896,587	E29G	probably benign	Het
Abi3bp	T	C	16: 56,671,265	S552P	probably damaging	Het
Adgrg7	A	G	16: 56,773,466	I129T	probably benign	Het
Adhfe1	A	G	1: 9,553,718	N148S	probably damaging	Het
AI182371	A	G	2: 35,097,971	Y77H	probably damaging	Het
Aldh5a1	C	T	13: 24,919,678		probably null	Het
Ankrd2	A	G	19: 42,040,105	T67A	possibly damaging	Het
Anln	A	T	9: 22,376,308	C232*	probably null	Het
C330027C09Rik	A	T	16: 48,994,329	K18*	probably null	Het
Cchcr1	A	G	17: 35,528,578	D587G	possibly damaging	Het
Cgn	G	T	3: 94,767,125	Q901K	possibly damaging	Het
Cluh	G	T	11: 74,667,228		probably null	Het
Crebbp	G	A	16: 4,084,623	Q2213*	probably null	Het
Cyp2d22	T	A	15: 82,373,835		probably null	Het
Dcdc2a	T	C	13: 25,205,457	V456A	probably benign	Het
Depdc5	A	G	5: 32,968,731	E569G	probably benign	Het
Dnah5	T	C	15: 28,459,185	F4517L	probably benign	Het
Doc2b	T	C	11: 75,773,595	K317E	probably damaging	Het
Dysf	T	A	6: 84,203,199	D1951E	probably damaging	Het
Epha6	C	A	16: 60,424,835	A334S	possibly damaging	Het
F2rl2	A	C	13: 95,700,641	I65L	probably benign	Het
Fbxw17	A	G	13: 50,432,512	K417E	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Fxr2	A	G	11: 69,641,339	M96V	possibly damaging	Het
Kcnj10	C	A	1: 172,369,325	Y135*	probably null	Het
Kidins220	G	A	12: 25,052,813	R1238Q	probably damaging	Het
Krt31	T	C	11: 100,048,230	N255S	probably benign	Het
Lrp2	T	C	2: 69,511,001	D945G	probably benign	Het
Lrrc66	T	C	5: 73,608,089	D537G	probably benign	Het
Ltbp4	T	A	7: 27,319,724	I992F	probably damaging	Het
Mrc2	C	A	11: 105,325,644	N86K	probably damaging	Het
Mroh6	C	A	15: 75,886,637	A302S	possibly damaging	Het
Muc16	T	A	9: 18,497,797	N198Y	probably damaging	Het
Myo9a	T	C	9: 59,871,229	S1423P	probably benign	Het
Olfr1006	T	A	2: 85,674,594	K186*	probably null	Het
Olfr1124	A	T	2: 87,435,318	D277V	possibly damaging	Het
Olfr1141	A	C	2: 87,753,258	L245R	probably damaging	Het
Olfr1367	A	T	13: 21,346,994	Y22F	possibly damaging	Het
Olfr190	A	G	16: 59,074,714	V122A	probably benign	Het
Olfr477	G	T	7: 107,990,413	G16V	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Polg	T	C	7: 79,450,512	M1184V	probably benign	Het
Prl8a8	T	C	13: 27,510,480	Y108C	probably damaging	Het
Proser1	T	A	3: 53,478,119	I474N	probably damaging	Het
Rab44	A	G	17: 29,135,417		probably benign	Het
Rbp1	C	A	9: 98,425,616	D79E	possibly damaging	Het
Rnf213	T	C	11: 119,435,999	V1605A	probably benign	Het
Rps24	A	T	14: 24,490,735		probably null	Het
Setd5	T	C	6: 113,121,812		probably null	Het
Slc38a3	T	C	9: 107,655,029	I435V	probably benign	Het
Slco1a5	T	A	6: 142,234,808	M623L	probably benign	Het
Spaca9	G	A	2: 28,693,781	R64W	probably damaging	Het
Spn	A	G	7: 127,136,307	S343P	possibly damaging	Het
Sptan1	A	G	2: 30,004,523	T1168A	probably benign	Het
Sptbn4	A	T	7: 27,364,587	L2138*	probably null	Het
Tg	T	A	15: 66,673,367		probably null	Het
Tigd5	T	A	15: 75,910,245	L152Q	probably damaging	Het
Tmem163	C	T	1: 127,519,389	V170I	probably benign	Het
Tpr	T	C	1: 150,423,162	C1068R	possibly damaging	Het
Ttc37	A	G	13: 76,185,240	E1536G	probably damaging	Het
Ubr1	A	T	2: 120,893,209	Y1290N	probably damaging	Het
Vmn1r184	T	A	7: 26,267,392	F188I	probably benign	Het
Vmn2r100	G	A	17: 19,522,260	V299I	probably benign	Het
Vmn2r91	T	G	17: 18,136,256	H728Q	probably benign	Het
Vta1	T	C	10: 14,705,352	Y37C	probably damaging	Het
Wbp2	C	A	11: 116,083,902	M35I	probably benign	Het
Zcchc9	G	A	13: 91,805,867	Q90*	probably null	Het

Other mutations in Lzts1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01065:Lzts1	APN	8	69136092	missense	probably benign	0.07
IGL01313:Lzts1	APN	8	69139107	missense	probably benign	0.11
IGL02371:Lzts1	APN	8	69138798	missense	probably damaging	0.99
IGL02508:Lzts1	APN	8	69140848	nonsense	probably null
IGL03238:Lzts1	APN	8	69138794	missense	probably damaging	1.00
R0645:Lzts1	UTSW	8	69135740	missense	possibly damaging	0.92
R1442:Lzts1	UTSW	8	69138986	missense	probably damaging	0.99
R1887:Lzts1	UTSW	8	69138833	missense	probably damaging	1.00
R2366:Lzts1	UTSW	8	69140605	splice site	probably null
R4238:Lzts1	UTSW	8	69135927	missense	possibly damaging	0.61
R4489:Lzts1	UTSW	8	69135695	missense	possibly damaging	0.94
R4508:Lzts1	UTSW	8	69135618	missense	probably benign	0.00
R4965:Lzts1	UTSW	8	69138762	missense	probably benign	0.44
R5159:Lzts1	UTSW	8	69138584	missense	probably benign	0.44
R5643:Lzts1	UTSW	8	69139077	missense	possibly damaging	0.94
R5644:Lzts1	UTSW	8	69139077	missense	possibly damaging	0.94
R5782:Lzts1	UTSW	8	69140698	missense	probably benign	0.00
R7069:Lzts1	UTSW	8	69140745	missense	probably damaging	1.00
R7444:Lzts1	UTSW	8	69135679	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATCTACTCCGGTCTGACCCC -3'
(R):5'- TTTCCCAGGCTCTAAGAAGC -3'

Sequencing Primer
(F):5'- CCACTGGACAGGGCTGTGTAG -3'
(R):5'- CCCAGGCTCTAAGAAGCTTTTG -3'

Posted On

2017-10-10