Incidental Mutation 'R0540:Pex16'
ID 49774
Institutional Source Beutler Lab
Gene Symbol Pex16
Ensembl Gene ENSMUSG00000027222
Gene Name peroxisomal biogenesis factor 16
Synonyms peroxisome biogenesis factor 16
MMRRC Submission 038732-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.411) question?
Stock # R0540 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 92205021-92211562 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 92205982 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 25 (L25*)
Ref Sequence ENSEMBL: ENSMUSP00000028650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028650] [ENSMUST00000068586] [ENSMUST00000090582] [ENSMUST00000111284] [ENSMUST00000148352] [ENSMUST00000176810] [ENSMUST00000176289] [ENSMUST00000176774] [ENSMUST00000176339]
AlphaFold Q91XC9
Predicted Effect probably null
Transcript: ENSMUST00000028650
AA Change: L25*
SMART Domains Protein: ENSMUSP00000028650
Gene: ENSMUSG00000027222
AA Change: L25*

DomainStartEndE-ValueType
Pfam:Pex16 9 329 1.3e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068586
SMART Domains Protein: ENSMUSP00000064128
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 316 4.6e-22 PFAM
low complexity region 392 401 N/A INTRINSIC
Pfam:Glyco_transf_49 402 469 2.2e-11 PFAM
Pfam:Glyco_transf_49 466 673 1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090582
SMART Domains Protein: ENSMUSP00000088070
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 218 7.2e-9 PFAM
Pfam:Glyco_transf_8 188 281 2.3e-8 PFAM
low complexity region 357 366 N/A INTRINSIC
Pfam:Glyco_transf_49 367 434 2.1e-11 PFAM
Pfam:Glyco_transf_49 431 638 9.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111284
SMART Domains Protein: ENSMUSP00000106915
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 97 341 8.9e-22 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 494 6.5e-11 PFAM
Pfam:Glyco_transf_49 491 698 3.1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146311
Predicted Effect probably benign
Transcript: ENSMUST00000148352
SMART Domains Protein: ENSMUSP00000135451
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175740
Predicted Effect probably benign
Transcript: ENSMUST00000176810
SMART Domains Protein: ENSMUSP00000135024
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 101 342 4.2e-20 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 493 1.3e-13 PFAM
Pfam:Glyco_transf_49 489 698 2.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176289
SMART Domains Protein: ENSMUSP00000135118
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176774
SMART Domains Protein: ENSMUSP00000135400
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 71 317 3.9e-22 PFAM
low complexity region 393 402 N/A INTRINSIC
Pfam:Glyco_transf_49 403 470 1.6e-11 PFAM
Pfam:Glyco_transf_49 467 674 7.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176339
SMART Domains Protein: ENSMUSP00000135619
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral peroxisomal membrane protein. An inactivating nonsense mutation localized to this gene was observed in a patient with Zellweger syndrome of the complementation group CGD/CG9. Expression of this gene product morphologically and biochemically restores the formation of new peroxisomes, suggesting a role in peroxisome organization and biogenesis. Alternative splicing has been observed for this gene and two variants have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 59,926,627 (GRCm39) T199A possibly damaging Het
Als2cl C A 9: 110,724,852 (GRCm39) Y775* probably null Het
Ankhd1 G T 18: 36,773,333 (GRCm39) V59F probably damaging Het
Ano4 T A 10: 88,859,806 (GRCm39) I395F probably benign Het
Apcdd1 A G 18: 63,084,967 (GRCm39) N388S possibly damaging Het
Arl9 A G 5: 77,155,118 (GRCm39) Y83C possibly damaging Het
Armc2 T A 10: 41,798,691 (GRCm39) H706L probably benign Het
Arrb1 T C 7: 99,237,403 (GRCm39) probably null Het
Atxn1 G A 13: 45,711,006 (GRCm39) S642L probably damaging Het
Bmp8a A G 4: 123,209,723 (GRCm39) Y322H probably damaging Het
Btbd3 C T 2: 138,125,736 (GRCm39) R307W possibly damaging Het
C1galt1 T C 6: 7,871,193 (GRCm39) I343T probably benign Het
Capn2 A T 1: 182,319,749 (GRCm39) Y146* probably null Het
Ccdc42 C T 11: 68,488,536 (GRCm39) Q312* probably null Het
Cd209e T C 8: 3,901,265 (GRCm39) K130E probably benign Het
Chd3 T C 11: 69,235,184 (GRCm39) D2054G probably damaging Het
Chrna1 T C 2: 73,401,815 (GRCm39) N161S probably damaging Het
Clp1 C T 2: 84,555,935 (GRCm39) A182T possibly damaging Het
Cpsf7 G T 19: 10,510,682 (GRCm39) E135* probably null Het
Csf2rb2 T C 15: 78,172,108 (GRCm39) Y325C probably benign Het
Cspg5 T C 9: 110,076,460 (GRCm39) probably null Het
Ctnna2 T C 6: 76,879,413 (GRCm39) T824A probably benign Het
Cyp2b13 G A 7: 25,781,136 (GRCm39) V183I probably benign Het
D430041D05Rik C T 2: 104,063,790 (GRCm39) R1354H probably damaging Het
Ddx24 A G 12: 103,385,326 (GRCm39) Y426H possibly damaging Het
Dexi G T 16: 10,360,426 (GRCm39) Y43* probably null Het
Dlg1 G A 16: 31,656,992 (GRCm39) V596I possibly damaging Het
Dnah11 A C 12: 118,046,246 (GRCm39) W1731G probably damaging Het
Dnhd1 T A 7: 105,369,995 (GRCm39) N4473K probably benign Het
Dync2h1 A C 9: 7,051,480 (GRCm39) S3152A probably benign Het
Edn3 C A 2: 174,602,767 (GRCm39) P3Q probably damaging Het
Eif2a G A 3: 58,463,073 (GRCm39) probably null Het
Emb G A 13: 117,369,286 (GRCm39) V56I possibly damaging Het
Enpp4 A T 17: 44,410,386 (GRCm39) C397S probably damaging Het
Exo5 A G 4: 120,779,178 (GRCm39) V229A probably damaging Het
Fga G A 3: 82,935,869 (GRCm39) G32E probably damaging Het
Fkbpl T C 17: 34,864,333 (GRCm39) F34L probably benign Het
Fsd2 T A 7: 81,194,765 (GRCm39) D466V probably damaging Het
Gcn1 T C 5: 115,727,015 (GRCm39) V624A probably benign Het
Git2 A G 5: 114,886,335 (GRCm39) F336L probably damaging Het
Greb1 T A 12: 16,732,194 (GRCm39) Y1589F probably damaging Het
H2-K2 G T 17: 34,218,474 (GRCm39) D127E probably damaging Het
Ints8 A G 4: 11,252,926 (GRCm39) V52A possibly damaging Het
Kifc1 G A 17: 34,105,621 (GRCm39) T62I probably damaging Het
Klhl6 C A 16: 19,775,764 (GRCm39) D265Y possibly damaging Het
Kmt5a T A 5: 124,589,373 (GRCm39) N190K probably damaging Het
Lce6a A T 3: 92,527,635 (GRCm39) H57Q probably benign Het
Lipo3 A T 19: 33,536,967 (GRCm39) I251K possibly damaging Het
Lnpep A T 17: 17,758,816 (GRCm39) F843I probably damaging Het
Lrrc45 C T 11: 120,605,988 (GRCm39) R99* probably null Het
Lrrtm1 C A 6: 77,221,611 (GRCm39) A356E probably damaging Het
Map3k1 A C 13: 111,900,044 (GRCm39) H493Q probably benign Het
Mcm4 A T 16: 15,449,979 (GRCm39) probably null Het
Mllt3 G A 4: 87,759,281 (GRCm39) P256S possibly damaging Het
Mrtfb A G 16: 13,199,465 (GRCm39) E106G probably damaging Het
Myo7a T A 7: 97,721,153 (GRCm39) T1271S probably damaging Het
Ncan C A 8: 70,567,809 (GRCm39) R101L possibly damaging Het
Ndufaf7 A G 17: 79,253,885 (GRCm39) D361G probably benign Het
Neurod6 C T 6: 55,656,572 (GRCm39) A22T probably benign Het
Nexn T A 3: 151,953,879 (GRCm39) K192* probably null Het
Nipsnap2 A T 5: 129,831,909 (GRCm39) Y234F probably damaging Het
Nlrp10 T C 7: 108,523,492 (GRCm39) K663E probably benign Het
Nprl2 A T 9: 107,422,497 (GRCm39) Y329F possibly damaging Het
Nr2f2 C A 7: 70,004,460 (GRCm39) R264L probably damaging Het
Nsun7 A T 5: 66,440,977 (GRCm39) K366I probably damaging Het
Nup35 T A 2: 80,472,984 (GRCm39) M19K probably benign Het
Or10a4 T A 7: 106,696,933 (GRCm39) I87K probably benign Het
Or11i1 A T 3: 106,729,829 (GRCm39) F15L probably damaging Het
Or1ad6 C A 11: 50,860,670 (GRCm39) A275D possibly damaging Het
Or2v1 C G 11: 49,025,549 (GRCm39) H177D probably damaging Het
Or2w2 T A 13: 21,757,948 (GRCm39) Y226F probably benign Het
Or5af1 T A 11: 58,722,798 (GRCm39) S273T probably damaging Het
Or5p51 A G 7: 107,444,776 (GRCm39) S55P probably damaging Het
Patl2 T C 2: 121,957,150 (GRCm39) Y128C probably benign Het
Pcdhac2 A G 18: 37,278,942 (GRCm39) I641V probably benign Het
Peli3 T C 19: 4,991,939 (GRCm39) M1V probably null Het
Plekhn1 C A 4: 156,307,204 (GRCm39) A449S possibly damaging Het
Pot1b A T 17: 55,972,765 (GRCm39) I469N probably damaging Het
Prdx6 A C 1: 161,078,673 (GRCm39) L5W probably damaging Het
Prrc1 G A 18: 57,507,622 (GRCm39) V259I possibly damaging Het
Prss38 T C 11: 59,266,369 (GRCm39) S30G possibly damaging Het
Rgs6 C A 12: 83,106,578 (GRCm39) Y151* probably null Het
Ripk4 A C 16: 97,545,375 (GRCm39) L361R probably damaging Het
Serpinb3d C T 1: 107,006,962 (GRCm39) D249N probably benign Het
Skint10 A T 4: 112,630,224 (GRCm39) probably null Het
Smg7 A T 1: 152,731,713 (GRCm39) N349K probably benign Het
Sohlh2 C A 3: 55,115,104 (GRCm39) S363Y probably damaging Het
Srsf10 A G 4: 135,591,179 (GRCm39) T210A possibly damaging Het
Synpo2l A T 14: 20,710,748 (GRCm39) M624K probably damaging Het
Thsd7a T A 6: 12,331,541 (GRCm39) probably null Het
Tnc A T 4: 63,938,692 (GRCm39) V49E probably damaging Het
Tnik A C 3: 28,704,308 (GRCm39) K989T probably damaging Het
Tnxb T A 17: 34,890,892 (GRCm39) Y412N probably damaging Het
Trmt44 A G 5: 35,726,103 (GRCm39) probably null Het
Tsc2 A T 17: 24,840,686 (GRCm39) V391E probably damaging Het
Ttll5 T C 12: 85,980,450 (GRCm39) probably null Het
Usp28 A G 9: 48,935,360 (GRCm39) I104V probably benign Het
Vmn1r64 A G 7: 5,887,096 (GRCm39) L149S probably damaging Het
Yme1l1 T A 2: 23,082,527 (GRCm39) M506K possibly damaging Het
Zfp280d T A 9: 72,215,247 (GRCm39) F98I probably damaging Het
Zfp62 C A 11: 49,106,227 (GRCm39) T106K probably benign Het
Other mutations in Pex16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pex16 APN 2 92,209,580 (GRCm39) missense probably benign 0.01
IGL01733:Pex16 APN 2 92,209,173 (GRCm39) missense probably damaging 1.00
IGL02642:Pex16 APN 2 92,206,981 (GRCm39) missense probably damaging 1.00
IGL03350:Pex16 APN 2 92,207,842 (GRCm39) missense probably damaging 0.97
R0143:Pex16 UTSW 2 92,210,802 (GRCm39) missense probably damaging 1.00
R0226:Pex16 UTSW 2 92,206,032 (GRCm39) unclassified probably benign
R0278:Pex16 UTSW 2 92,211,401 (GRCm39) missense probably damaging 1.00
R0375:Pex16 UTSW 2 92,210,802 (GRCm39) missense probably damaging 1.00
R0437:Pex16 UTSW 2 92,205,937 (GRCm39) missense probably damaging 1.00
R4809:Pex16 UTSW 2 92,206,983 (GRCm39) missense probably damaging 1.00
R4841:Pex16 UTSW 2 92,209,544 (GRCm39) splice site probably null
R4952:Pex16 UTSW 2 92,209,405 (GRCm39) nonsense probably null
R5382:Pex16 UTSW 2 92,207,875 (GRCm39) missense possibly damaging 0.85
R8144:Pex16 UTSW 2 92,205,985 (GRCm39) missense probably damaging 1.00
R8810:Pex16 UTSW 2 92,209,366 (GRCm39) unclassified probably benign
R9511:Pex16 UTSW 2 92,209,559 (GRCm39) critical splice acceptor site probably null
R9712:Pex16 UTSW 2 92,206,988 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTAGTATGAACTGTTCAGCCTGCCC -3'
(R):5'- AGTTTCCTCTACGCCACAGGAACC -3'

Sequencing Primer
(F):5'- TCTAGAGAGCTTCAGGGCG -3'
(R):5'- CAGGAACCCAGACAGAACTGAAG -3'
Posted On 2013-06-12