Incidental Mutation 'R0017:Appbp2'
ID50124
Institutional Source Beutler Lab
Gene Symbol Appbp2
Ensembl Gene ENSMUSG00000018481
Gene Nameamyloid beta precursor protein (cytoplasmic tail) binding protein 2
SynonymsPAT1, 1300003O07Rik
MMRRC Submission 038312-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock #R0017 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location85187262-85235130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85214303 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 146 (C146G)
Ref Sequence ENSEMBL: ENSMUSP00000018625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018625]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018625
AA Change: C146G

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018625
Gene: ENSMUSG00000018481
AA Change: C146G

DomainStartEndE-ValueType
Pfam:TPR_12 395 461 6.5e-13 PFAM
Pfam:TPR_10 428 467 1.1e-9 PFAM
Pfam:TPR_7 432 466 1.2e-5 PFAM
Pfam:TPR_10 470 509 8.9e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119676
Meta Mutation Damage Score 0.5678 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.0%
  • 20x: 89.2%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik G T 17: 9,008,106 probably benign Het
Abca13 T A 11: 9,292,775 I1546N probably damaging Het
Actrt3 A T 3: 30,598,273 M224K probably benign Het
Adgrv1 T C 13: 81,578,946 N429S probably benign Het
Cabp2 A C 19: 4,086,242 D83A possibly damaging Het
Ccl1 A G 11: 82,178,017 probably null Het
Cdca8 T C 4: 124,920,375 T208A probably benign Het
Dach1 C T 14: 98,168,748 G188R probably damaging Het
Dcdc5 G A 2: 106,357,196 noncoding transcript Het
Efr3b C A 12: 3,993,003 C89F probably damaging Het
Enpp3 C T 10: 24,799,153 probably null Het
Ep400 A T 5: 110,673,529 V2467E probably damaging Het
Ermap T C 4: 119,179,948 probably benign Het
Fig4 A G 10: 41,273,007 Y150H possibly damaging Het
Fsip2 G A 2: 82,992,072 V6050M probably damaging Het
Gm11397 A C 13: 33,404,511 I360L probably damaging Het
Gnb1l T C 16: 18,541,060 W72R probably damaging Het
Gpld1 A G 13: 24,990,118 D842G probably damaging Het
Hmgcr A G 13: 96,652,089 probably benign Het
Hrc A G 7: 45,336,370 H315R possibly damaging Het
Ifit2 A T 19: 34,573,573 N171I probably damaging Het
Ipo11 T A 13: 106,886,730 I416L probably benign Het
Kcnab1 G A 3: 65,357,106 V259M probably damaging Het
Kcng4 T C 8: 119,633,520 Y39C probably damaging Het
Kif5c A G 2: 49,732,713 T526A probably benign Het
Kntc1 A G 5: 123,780,981 Y805C probably damaging Het
Mal A G 2: 127,640,307 S59P probably damaging Het
Myh15 A G 16: 49,163,060 N1513D probably damaging Het
Ncoa2 A G 1: 13,174,752 L574P probably damaging Het
Nmd3 A G 3: 69,736,092 probably null Het
Nucb2 A G 7: 116,533,151 D331G probably benign Het
Nwd1 T C 8: 72,709,425 probably benign Het
Nynrin T C 14: 55,872,395 F1653S probably damaging Het
Olfr1253 A C 2: 89,752,021 I269S possibly damaging Het
Olfr371 T A 8: 85,231,077 I194N probably benign Het
Olfr875 T G 9: 37,772,978 F106L probably benign Het
Pfdn6 T C 17: 33,939,564 R79G probably damaging Het
Pkd1 G T 17: 24,578,539 probably null Het
Pramel4 T G 4: 144,068,344 C434G probably benign Het
Ptpn13 T C 5: 103,486,772 probably null Het
Ptpro T C 6: 137,416,827 V831A probably benign Het
Rabl6 A T 2: 25,602,567 probably benign Het
Reg3b T A 6: 78,372,861 M128K possibly damaging Het
Rif1 A G 2: 52,116,674 T2207A probably benign Het
Rpa1 A C 11: 75,314,861 N223K probably null Het
Rras2 T C 7: 114,048,255 probably benign Het
Ryr1 T A 7: 29,047,542 E3760V probably damaging Het
Scyl3 T A 1: 163,939,969 I204N possibly damaging Het
Slc16a12 A G 19: 34,672,698 probably benign Het
Slc22a1 A G 17: 12,659,759 F356L probably damaging Het
Slc22a29 A G 19: 8,218,266 probably benign Het
Slc45a1 C A 4: 150,629,566 D741Y possibly damaging Het
Slco1a5 A T 6: 142,236,335 probably benign Het
Smg5 G T 3: 88,351,105 R461L probably damaging Het
Snrk T C 9: 122,166,240 S362P probably damaging Het
Spata31d1b A G 13: 59,716,069 S344G probably benign Het
Sync G A 4: 129,293,744 V190M probably damaging Het
Taf5l T C 8: 124,003,644 Y67C probably damaging Het
Tbkbp1 A G 11: 97,146,289 probably benign Het
Tshr A T 12: 91,537,886 I533F possibly damaging Het
Tsn T C 1: 118,300,859 D211G probably damaging Het
Ttn G A 2: 76,791,644 T15518I probably benign Het
Unc13c T C 9: 73,693,301 D1387G probably benign Het
Vapb A G 2: 173,771,604 T99A probably benign Het
Vmn2r-ps119 A G 17: 19,153,617 noncoding transcript Het
Zfp280d A T 9: 72,339,010 probably null Het
Other mutations in Appbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Appbp2 APN 11 85214317 missense possibly damaging 0.86
IGL02112:Appbp2 APN 11 85201620 missense probably benign 0.04
IGL03051:Appbp2 APN 11 85191739 missense possibly damaging 0.90
IGL03068:Appbp2 APN 11 85201420 missense probably damaging 1.00
IGL03260:Appbp2 APN 11 85216457 missense probably benign 0.00
IGL03358:Appbp2 APN 11 85210034 missense probably benign 0.17
R0267:Appbp2 UTSW 11 85201462 missense probably damaging 1.00
R0504:Appbp2 UTSW 11 85191687 missense probably benign 0.05
R1661:Appbp2 UTSW 11 85210110 critical splice acceptor site probably null
R3438:Appbp2 UTSW 11 85198140 missense probably damaging 1.00
R3817:Appbp2 UTSW 11 85198108 missense probably damaging 1.00
R3950:Appbp2 UTSW 11 85194706 missense probably damaging 1.00
R4273:Appbp2 UTSW 11 85234676 missense probably damaging 1.00
R4574:Appbp2 UTSW 11 85209938 critical splice donor site probably null
R4948:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R5322:Appbp2 UTSW 11 85196064 critical splice donor site probably null
R5581:Appbp2 UTSW 11 85210095 missense possibly damaging 0.92
R5593:Appbp2 UTSW 11 85194583 missense possibly damaging 0.87
R5698:Appbp2 UTSW 11 85210099 missense probably damaging 1.00
R7095:Appbp2 UTSW 11 85234727 nonsense probably null
R7141:Appbp2 UTSW 11 85191751 nonsense probably null
X0058:Appbp2 UTSW 11 85201630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAAGCCCAAAGCACTAGCACTG -3'
(R):5'- AGGCATACATCTTCTCAGGGACCG -3'

Sequencing Primer
(F):5'- TAGCACTGAGTACCACTATAACTAAG -3'
(R):5'- CTACTGTAAGGATAGCAGAAACATC -3'
Posted On2013-06-13