Mutagenetix > Incidental Mutation

Incidental Mutation 'R0017:Enpp3'

19359

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

038312-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.194) question?

Stock #

R0017 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 24799153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169]

AlphaFold

Q6DYE8

Predicted Effect

probably null
Transcript: ENSMUST00000020169

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218343

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218619

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 95.0%
20x: 89.2%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	G	T	17: 9,008,106		probably benign	Het
Abca13	T	A	11: 9,292,775	I1546N	probably damaging	Het
Actrt3	A	T	3: 30,598,273	M224K	probably benign	Het
Adgrv1	T	C	13: 81,578,946	N429S	probably benign	Het
Appbp2	A	C	11: 85,214,303	C146G	possibly damaging	Het
Cabp2	A	C	19: 4,086,242	D83A	possibly damaging	Het
Ccl1	A	G	11: 82,178,017		probably null	Het
Cdca8	T	C	4: 124,920,375	T208A	probably benign	Het
Dach1	C	T	14: 98,168,748	G188R	probably damaging	Het
Dcdc5	G	A	2: 106,357,196		noncoding transcript	Het
Efr3b	C	A	12: 3,993,003	C89F	probably damaging	Het
Ep400	A	T	5: 110,673,529	V2467E	probably damaging	Het
Ermap	T	C	4: 119,179,948		probably benign	Het
Fig4	A	G	10: 41,273,007	Y150H	possibly damaging	Het
Fsip2	G	A	2: 82,992,072	V6050M	probably damaging	Het
Gm11397	A	C	13: 33,404,511	I360L	probably damaging	Het
Gnb1l	T	C	16: 18,541,060	W72R	probably damaging	Het
Gpld1	A	G	13: 24,990,118	D842G	probably damaging	Het
Hmgcr	A	G	13: 96,652,089		probably benign	Het
Hrc	A	G	7: 45,336,370	H315R	possibly damaging	Het
Ifit2	A	T	19: 34,573,573	N171I	probably damaging	Het
Ipo11	T	A	13: 106,886,730	I416L	probably benign	Het
Kcnab1	G	A	3: 65,357,106	V259M	probably damaging	Het
Kcng4	T	C	8: 119,633,520	Y39C	probably damaging	Het
Kif5c	A	G	2: 49,732,713	T526A	probably benign	Het
Kntc1	A	G	5: 123,780,981	Y805C	probably damaging	Het
Mal	A	G	2: 127,640,307	S59P	probably damaging	Het
Myh15	A	G	16: 49,163,060	N1513D	probably damaging	Het
Ncoa2	A	G	1: 13,174,752	L574P	probably damaging	Het
Nmd3	A	G	3: 69,736,092		probably null	Het
Nucb2	A	G	7: 116,533,151	D331G	probably benign	Het
Nwd1	T	C	8: 72,709,425		probably benign	Het
Nynrin	T	C	14: 55,872,395	F1653S	probably damaging	Het
Olfr1253	A	C	2: 89,752,021	I269S	possibly damaging	Het
Olfr371	T	A	8: 85,231,077	I194N	probably benign	Het
Olfr875	T	G	9: 37,772,978	F106L	probably benign	Het
Pfdn6	T	C	17: 33,939,564	R79G	probably damaging	Het
Pkd1	G	T	17: 24,578,539		probably null	Het
Pramel4	T	G	4: 144,068,344	C434G	probably benign	Het
Ptpn13	T	C	5: 103,486,772		probably null	Het
Ptpro	T	C	6: 137,416,827	V831A	probably benign	Het
Rabl6	A	T	2: 25,602,567		probably benign	Het
Reg3b	T	A	6: 78,372,861	M128K	possibly damaging	Het
Rif1	A	G	2: 52,116,674	T2207A	probably benign	Het
Rpa1	A	C	11: 75,314,861	N223K	probably null	Het
Rras2	T	C	7: 114,048,255		probably benign	Het
Ryr1	T	A	7: 29,047,542	E3760V	probably damaging	Het
Scyl3	T	A	1: 163,939,969	I204N	possibly damaging	Het
Slc16a12	A	G	19: 34,672,698		probably benign	Het
Slc22a1	A	G	17: 12,659,759	F356L	probably damaging	Het
Slc22a29	A	G	19: 8,218,266		probably benign	Het
Slc45a1	C	A	4: 150,629,566	D741Y	possibly damaging	Het
Slco1a5	A	T	6: 142,236,335		probably benign	Het
Smg5	G	T	3: 88,351,105	R461L	probably damaging	Het
Snrk	T	C	9: 122,166,240	S362P	probably damaging	Het
Spata31d1b	A	G	13: 59,716,069	S344G	probably benign	Het
Sync	G	A	4: 129,293,744	V190M	probably damaging	Het
Taf5l	T	C	8: 124,003,644	Y67C	probably damaging	Het
Tbkbp1	A	G	11: 97,146,289		probably benign	Het
Tshr	A	T	12: 91,537,886	I533F	possibly damaging	Het
Tsn	T	C	1: 118,300,859	D211G	probably damaging	Het
Ttn	G	A	2: 76,791,644	T15518I	probably benign	Het
Unc13c	T	C	9: 73,693,301	D1387G	probably benign	Het
Vapb	A	G	2: 173,771,604	T99A	probably benign	Het
Vmn2r-ps119	A	G	17: 19,153,617		noncoding transcript	Het
Zfp280d	A	T	9: 72,339,010		probably null	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6735:Enpp3	UTSW	10	24807453	missense	probably damaging	1.00
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTGCTGAAAGGCAGCCTGAAG -3'
(R):5'- CCCAGAAAGGGTGAGATGCTTACATAC -3'

Sequencing Primer
(F):5'- GGACCACATTTTTGTGAGCTAC -3'
(R):5'- ttgtttgtttgtttttgtttttttgC -3'

Posted On

2013-04-11