Incidental Mutation 'R6222:Ldlrap1'
ID504070
Institutional Source Beutler Lab
Gene Symbol Ldlrap1
Ensembl Gene ENSMUSG00000037295
Gene Namelow density lipoprotein receptor adaptor protein 1
SynonymsArh, Arh1
MMRRC Submission 044353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6222 (G1)
Quality Score214.009
Status Not validated
Chromosome4
Chromosomal Location134741554-134768024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134757360 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 108 (E108K)
Ref Sequence ENSEMBL: ENSMUSP00000036749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037828]
Predicted Effect probably damaging
Transcript: ENSMUST00000037828
AA Change: E108K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036749
Gene: ENSMUSG00000037295
AA Change: E108K

DomainStartEndE-ValueType
PTB 42 177 4.92e-40 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic protein which contains a phosphotyrosine binding (PTD) domain. The PTD domain has been found to interact with the cytoplasmic tail of the LDL receptor. Mutations in this gene lead to LDL receptor malfunction and cause the disorder autosomal recessive hypercholesterolaemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have increased levels of circulating LDL cholesterol and total plasmsa cholesterol and are physiologically similar to humans with autosomal recessive hypercholesterolemia (ARH). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Ldlrap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01076:Ldlrap1 APN 4 134749982 missense probably benign 0.03
IGL02303:Ldlrap1 APN 4 134757395 missense probably damaging 1.00
R0129:Ldlrap1 UTSW 4 134757422 missense probably damaging 1.00
R3841:Ldlrap1 UTSW 4 134750436 missense probably damaging 0.97
R4233:Ldlrap1 UTSW 4 134757338 splice site probably null
R4884:Ldlrap1 UTSW 4 134758971 missense probably benign
R5871:Ldlrap1 UTSW 4 134758929 missense probably damaging 1.00
R6221:Ldlrap1 UTSW 4 134757360 missense probably damaging 0.96
R6232:Ldlrap1 UTSW 4 134759034 missense possibly damaging 0.82
R6939:Ldlrap1 UTSW 4 134767974 start gained probably benign
R7472:Ldlrap1 UTSW 4 134758996 missense possibly damaging 0.61
R8407:Ldlrap1 UTSW 4 134757425 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCAGCTGGTTAGGGAACAG -3'
(R):5'- CAGTTGAGTGTCCTCCTGTG -3'

Sequencing Primer
(F):5'- GGGTTTCTCAGTGGCACAACATAAC -3'
(R):5'- GTCCTCCTGTGGCCCCTG -3'
Posted On2018-02-28