Incidental Mutation 'R6332:Matn2'
ID513198
Institutional Source Beutler Lab
Gene Symbol Matn2
Ensembl Gene ENSMUSG00000022324
Gene Namematrilin 2
SynonymsCrtm2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6332 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location34306677-34436273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 34423755 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 586 (E586D)
Ref Sequence ENSEMBL: ENSMUSP00000154040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022947] [ENSMUST00000163455] [ENSMUST00000227759] [ENSMUST00000228570]
Predicted Effect probably benign
Transcript: ENSMUST00000022947
AA Change: E586D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022947
Gene: ENSMUSG00000022324
AA Change: E586D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 889 935 4.78e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163455
AA Change: E586D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128202
Gene: ENSMUSG00000022324
AA Change: E586D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 55 237 1.99e-49 SMART
EGF 241 278 6.86e-4 SMART
EGF 282 319 5.49e-3 SMART
EGF 323 360 7.88e-4 SMART
EGF 364 401 6.76e-3 SMART
EGF 405 442 4.39e-2 SMART
EGF 446 483 9.41e-2 SMART
EGF 487 524 1.24e-1 SMART
EGF 528 565 2.23e-3 SMART
EGF 569 606 8.44e-4 SMART
EGF 610 647 9.55e-3 SMART
VWA 653 831 1.14e-49 SMART
Matrilin_ccoil 908 955 7.77e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227759
AA Change: E586D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228570
AA Change: E586D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Agt G T 8: 124,557,833 Q389K possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Itgae A G 11: 73,111,402 probably null Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lamp3 A G 16: 19,699,681 C269R probably damaging Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr1308 C T 2: 111,960,746 G109D probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Pdpk1 A T 17: 24,106,922 V100D probably damaging Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rasal2 A G 1: 157,299,187 Y94H probably damaging Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Slco5a1 C T 1: 12,921,185 V427I probably benign Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vmn2r10 G T 5: 109,003,462 N95K probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp26 A T 9: 20,437,286 F661I probably damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Matn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Matn2 APN 15 34428470 missense probably damaging 1.00
IGL00392:Matn2 APN 15 34402856 missense probably benign 0.00
IGL01475:Matn2 APN 15 34316525 missense possibly damaging 0.94
IGL02223:Matn2 APN 15 34423718 missense probably benign 0.00
IGL02252:Matn2 APN 15 34316590 missense probably damaging 0.98
IGL02288:Matn2 APN 15 34422386 missense probably damaging 1.00
IGL02738:Matn2 APN 15 34388739 missense probably benign 0.07
IGL02927:Matn2 APN 15 34355655 missense probably damaging 1.00
IGL03331:Matn2 APN 15 34345357 missense probably damaging 1.00
Engorged UTSW 15 34426234 missense probably damaging 1.00
PIT4260001:Matn2 UTSW 15 34428731 missense possibly damaging 0.78
R0124:Matn2 UTSW 15 34426151 splice site probably benign
R0422:Matn2 UTSW 15 34435771 unclassified probably null
R0449:Matn2 UTSW 15 34428541 missense probably damaging 1.00
R0606:Matn2 UTSW 15 34345150 missense probably damaging 1.00
R0655:Matn2 UTSW 15 34345200 missense probably benign 0.03
R0885:Matn2 UTSW 15 34316605 missense possibly damaging 0.67
R1384:Matn2 UTSW 15 34409810 missense probably benign 0.00
R1603:Matn2 UTSW 15 34388768 missense probably damaging 1.00
R1667:Matn2 UTSW 15 34378732 missense probably damaging 0.99
R1720:Matn2 UTSW 15 34345274 nonsense probably null
R1772:Matn2 UTSW 15 34428785 missense probably damaging 0.99
R2037:Matn2 UTSW 15 34433117 missense probably benign 0.00
R2107:Matn2 UTSW 15 34423759 missense probably damaging 1.00
R2240:Matn2 UTSW 15 34433063 missense probably damaging 1.00
R3933:Matn2 UTSW 15 34345420 unclassified probably null
R3963:Matn2 UTSW 15 34388791 nonsense probably null
R4648:Matn2 UTSW 15 34428533 missense probably damaging 1.00
R4695:Matn2 UTSW 15 34402925 missense probably damaging 1.00
R4817:Matn2 UTSW 15 34423799 missense probably damaging 1.00
R4935:Matn2 UTSW 15 34428685 missense probably damaging 1.00
R5105:Matn2 UTSW 15 34355668 missense possibly damaging 0.95
R5177:Matn2 UTSW 15 34433514 missense possibly damaging 0.58
R5717:Matn2 UTSW 15 34399091 nonsense probably null
R5760:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R5776:Matn2 UTSW 15 34431619 missense probably damaging 1.00
R5842:Matn2 UTSW 15 34399056 missense probably damaging 0.99
R5917:Matn2 UTSW 15 34409766 nonsense probably null
R5964:Matn2 UTSW 15 34410165 missense probably damaging 1.00
R6265:Matn2 UTSW 15 34399155 missense probably damaging 1.00
R6272:Matn2 UTSW 15 34355607 missense possibly damaging 0.46
R6457:Matn2 UTSW 15 34426234 missense probably damaging 1.00
R7351:Matn2 UTSW 15 34345336 missense probably damaging 0.97
R7660:Matn2 UTSW 15 34402946 missense probably benign 0.00
R7660:Matn2 UTSW 15 34423728 nonsense probably null
R7775:Matn2 UTSW 15 34399077 missense possibly damaging 0.94
R7778:Matn2 UTSW 15 34399077 missense possibly damaging 0.94
R8007:Matn2 UTSW 15 34426169 missense probably benign 0.01
R8059:Matn2 UTSW 15 34345335 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGACTTCATCCAGCTTC -3'
(R):5'- AGTCAGCTCACTTGATCCCTTG -3'

Sequencing Primer
(F):5'- AGCTTCACCTTCCTACTCAAG -3'
(R):5'- TTGATCCCTTGGAAACACCTTCAGAG -3'
Posted On2018-04-27