Incidental Mutation 'R6307:Sema6a'
ID509510
Institutional Source Beutler Lab
Gene Symbol Sema6a
Ensembl Gene ENSMUSG00000019647
Gene Namesema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonymssema, Sema6A-1, Semaq, A730020P05Rik, VIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6307 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location47235598-47368870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 47249164 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 772 (R772L)
Ref Sequence ENSEMBL: ENSMUSP00000121442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019791] [ENSMUST00000076043] [ENSMUST00000115449] [ENSMUST00000135790] [ENSMUST00000156422]
Predicted Effect probably damaging
Transcript: ENSMUST00000019791
AA Change: R772L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019791
Gene: ENSMUSG00000019647
AA Change: R772L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076043
AA Change: R717L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075420
Gene: ENSMUSG00000019647
AA Change: R717L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 593 615 N/A INTRINSIC
low complexity region 877 896 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115449
AA Change: R746L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111109
Gene: ENSMUSG00000019647
AA Change: R746L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 461 1.24e-168 SMART
PSI 488 543 9.57e-1 SMART
transmembrane domain 622 644 N/A INTRINSIC
low complexity region 906 925 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123228
SMART Domains Protein: ENSMUSP00000120249
Gene: ENSMUSG00000019647

DomainStartEndE-ValueType
Blast:PSI 2 45 4e-26 BLAST
PDB:3OKY|B 2 47 2e-26 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000135790
AA Change: R789L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120011
Gene: ENSMUSG00000019647
AA Change: R789L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156422
AA Change: R772L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121442
Gene: ENSMUSG00000019647
AA Change: R772L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 56 487 1.06e-185 SMART
PSI 514 569 9.57e-1 SMART
transmembrane domain 648 670 N/A INTRINSIC
low complexity region 932 951 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transmembrane semaphorin SEMA6A is expressed in developing neural tissue and is required for proper development of the thalamocortical projection (Leighton et al., 2001 [PubMed 11242070]).[supplied by OMIM, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit defects in lamina-specific neurite stratification of specific retinal neuron subtypes and disruption of the dendritic plexus organization of On but not Off starburst amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,007,387 L1232P probably damaging Het
Akap6 A T 12: 53,141,568 I1922F possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arpc5 T C 1: 152,771,455 V103A possibly damaging Het
Atp9a C A 2: 168,668,170 V430F probably benign Het
Bod1 A G 11: 31,666,932 S110P probably damaging Het
Cacna1c C A 6: 118,613,953 V1453F probably damaging Het
Capn8 T A 1: 182,607,699 M414K probably damaging Het
Cbl A T 9: 44,158,512 probably null Het
Ccdc42 A T 11: 68,588,280 Q98L probably damaging Het
Cd200 C A 16: 45,397,182 V49L probably benign Het
Celsr1 A G 15: 85,928,330 S2060P probably benign Het
Ces1g A T 8: 93,331,192 H160Q possibly damaging Het
Chrnb2 G T 3: 89,761,524 H161Q probably damaging Het
Ctns G A 11: 73,191,733 T57I probably benign Het
Cyp3a25 A T 5: 145,994,956 M114K possibly damaging Het
D630003M21Rik A G 2: 158,215,951 F536L probably benign Het
Dcc C T 18: 71,810,755 R275Q probably benign Het
Dmxl2 A T 9: 54,382,706 H2508Q possibly damaging Het
Elf5 C A 2: 103,439,412 Q113K probably damaging Het
Fam83a T G 15: 57,986,111 V17G possibly damaging Het
Farsa T C 8: 84,861,045 probably null Het
Fat2 G C 11: 55,281,280 T2869S possibly damaging Het
Fgg A T 3: 83,012,976 Q354L probably damaging Het
Folh1 T C 7: 86,723,309 D679G probably damaging Het
Gbp4 T A 5: 105,123,109 R83* probably null Het
Gm17482 T A 6: 115,227,350 probably benign Het
Hmgxb4 T A 8: 75,023,299 V481D possibly damaging Het
Ifi207 A C 1: 173,725,053 Y926D probably damaging Het
Ikzf5 T A 7: 131,391,648 N264Y probably damaging Het
Kat6a T A 8: 22,940,368 M1913K unknown Het
Krt33b A T 11: 100,024,868 C351S probably benign Het
Lrp1 T C 10: 127,592,075 D543G probably damaging Het
Lrrfip2 C T 9: 111,223,953 R339W probably damaging Het
Mapk3 T G 7: 126,764,282 M276R probably benign Het
Mgst1 T C 6: 138,150,829 V137A probably benign Het
Muc16 T C 9: 18,647,588 T2470A unknown Het
Muc4 C T 16: 32,753,946 S1274F possibly damaging Het
Myo5c A C 9: 75,272,916 K713T possibly damaging Het
Myzap T C 9: 71,558,864 D170G possibly damaging Het
Naa50 T C 16: 44,159,468 V113A probably damaging Het
Neu3 T C 7: 99,813,722 T265A probably benign Het
Nin T C 12: 70,014,857 T2078A possibly damaging Het
Nomo1 G A 7: 46,033,836 probably benign Het
Nov T C 15: 54,748,025 probably null Het
Nprl3 A G 11: 32,239,828 L273P probably damaging Het
Oaf T A 9: 43,224,919 H120L possibly damaging Het
Olfr1053 T C 2: 86,315,124 H54R probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Olfr982 T C 9: 40,074,528 S78P probably damaging Het
Pcdhga3 T A 18: 37,676,621 probably null Het
Polq G A 16: 37,017,356 probably null Het
Prdm8 C T 5: 98,185,303 P243L possibly damaging Het
Prim2 T C 1: 33,662,292 D138G probably benign Het
Prl2c5 A G 13: 13,190,590 E107G probably benign Het
Prr14l T A 5: 32,827,525 H1542L probably damaging Het
Rab26 T C 17: 24,530,098 E203G probably damaging Het
Rtkn2 A T 10: 68,035,832 H350L possibly damaging Het
Scara3 T C 14: 65,938,261 D19G probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Sdcbp A G 4: 6,385,059 M93V probably benign Het
Slc5a7 T C 17: 54,276,978 K428R probably benign Het
Sptbn2 G A 19: 4,724,646 G109D probably damaging Het
Tmppe T C 9: 114,404,744 L37P probably benign Het
Tuba1a T C 15: 98,951,529 T56A probably benign Het
Vmn2r111 A G 17: 22,573,089 I62T probably benign Het
Vmn2r73 A G 7: 85,857,620 I828T probably damaging Het
Vmn2r79 T A 7: 87,037,768 W786R probably damaging Het
Zcchc11 T A 4: 108,555,620 I1506N probably damaging Het
Zp1 G A 19: 10,916,720 T405M probably null Het
Other mutations in Sema6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Sema6a APN 18 47289975 critical splice donor site probably null
IGL01351:Sema6a APN 18 47281302 missense possibly damaging 0.84
IGL01594:Sema6a APN 18 47248817 missense probably damaging 1.00
IGL01953:Sema6a APN 18 47290120 nonsense probably null
IGL02077:Sema6a APN 18 47283398 missense possibly damaging 0.94
IGL02632:Sema6a APN 18 47290155 missense probably damaging 1.00
IGL02957:Sema6a APN 18 47249224 missense probably damaging 1.00
IGL03013:Sema6a APN 18 47248394 missense probably benign 0.01
IGL03279:Sema6a APN 18 47300090 nonsense probably null
saphire UTSW 18 47306429 nonsense probably null
IGL02988:Sema6a UTSW 18 47298214 missense probably damaging 1.00
R0114:Sema6a UTSW 18 47290177 missense probably damaging 1.00
R0311:Sema6a UTSW 18 47290045 unclassified probably null
R0312:Sema6a UTSW 18 47290045 unclassified probably null
R0347:Sema6a UTSW 18 47291129 missense probably damaging 1.00
R0350:Sema6a UTSW 18 47270718 missense probably benign
R0366:Sema6a UTSW 18 47290045 unclassified probably null
R0368:Sema6a UTSW 18 47290045 unclassified probably null
R0391:Sema6a UTSW 18 47290045 unclassified probably null
R0403:Sema6a UTSW 18 47290045 unclassified probably null
R0466:Sema6a UTSW 18 47290045 unclassified probably null
R0515:Sema6a UTSW 18 47290045 unclassified probably null
R0517:Sema6a UTSW 18 47290045 unclassified probably null
R0542:Sema6a UTSW 18 47248576 missense probably damaging 1.00
R0557:Sema6a UTSW 18 47249500 missense probably benign 0.01
R0569:Sema6a UTSW 18 47270805 splice site probably null
R0650:Sema6a UTSW 18 47290045 unclassified probably null
R0689:Sema6a UTSW 18 47290045 unclassified probably null
R0694:Sema6a UTSW 18 47290045 unclassified probably null
R0726:Sema6a UTSW 18 47291981 missense probably damaging 1.00
R0741:Sema6a UTSW 18 47290045 unclassified probably null
R0821:Sema6a UTSW 18 47290045 unclassified probably null
R0824:Sema6a UTSW 18 47290045 unclassified probably null
R0924:Sema6a UTSW 18 47248492 missense probably damaging 1.00
R1108:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1255:Sema6a UTSW 18 47249299 missense probably damaging 0.98
R1422:Sema6a UTSW 18 47306431 missense probably benign 0.02
R1531:Sema6a UTSW 18 47248999 missense probably damaging 1.00
R1707:Sema6a UTSW 18 47283445 missense probably benign 0.04
R1746:Sema6a UTSW 18 47306349 splice site probably benign
R1807:Sema6a UTSW 18 47276424 missense possibly damaging 0.85
R1974:Sema6a UTSW 18 47270629 missense probably benign 0.04
R1987:Sema6a UTSW 18 47300142 missense probably damaging 1.00
R2044:Sema6a UTSW 18 47306429 nonsense probably null
R3719:Sema6a UTSW 18 47249077 missense probably damaging 1.00
R4491:Sema6a UTSW 18 47306457 utr 5 prime probably benign
R4552:Sema6a UTSW 18 47291923 missense probably damaging 1.00
R4707:Sema6a UTSW 18 47248712 missense probably benign 0.43
R4710:Sema6a UTSW 18 47270683 missense probably benign 0.00
R4713:Sema6a UTSW 18 47249296 missense possibly damaging 0.79
R4963:Sema6a UTSW 18 47298251 missense possibly damaging 0.48
R5088:Sema6a UTSW 18 47249129 missense probably damaging 1.00
R5133:Sema6a UTSW 18 47300128 missense probably damaging 1.00
R5135:Sema6a UTSW 18 47291172 missense probably damaging 1.00
R5141:Sema6a UTSW 18 47248388 missense probably damaging 1.00
R5277:Sema6a UTSW 18 47276544 intron probably benign
R5551:Sema6a UTSW 18 47248528 missense possibly damaging 0.76
R5618:Sema6a UTSW 18 47281948 missense probably damaging 0.98
R5717:Sema6a UTSW 18 47249263 missense probably benign 0.01
R5729:Sema6a UTSW 18 47281343 missense probably damaging 1.00
R5779:Sema6a UTSW 18 47248826 missense probably damaging 1.00
R5917:Sema6a UTSW 18 47281338 missense probably benign 0.05
R6054:Sema6a UTSW 18 47283403 missense possibly damaging 0.94
R6142:Sema6a UTSW 18 47281199 missense probably benign 0.00
R6209:Sema6a UTSW 18 47298302 splice site probably null
R6734:Sema6a UTSW 18 47279169 missense probably benign 0.31
R7014:Sema6a UTSW 18 47298217 missense probably damaging 1.00
R7033:Sema6a UTSW 18 47248570 missense probably damaging 0.96
X0065:Sema6a UTSW 18 47283319 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CGCTCATTTTGGGCTGATCTAC -3'
(R):5'- CAAGCTCAGTGGCCTCTTTG -3'

Sequencing Primer
(F):5'- TGGGCTGATCTACGTACTCG -3'
(R):5'- AGTGGCCTCTTTGGGGACAC -3'
Posted On2018-04-02