Incidental Mutation 'R6314:Olfr186'
ID509964
Institutional Source Beutler Lab
Gene Symbol Olfr186
Ensembl Gene ENSMUSG00000047960
Gene Nameolfactory receptor 186
SynonymsGA_x54KRFPKG5P-55257214-55256285, MOR183-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59025797-59030291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59027457 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 150 (I150K)
Ref Sequence ENSEMBL: ENSMUSP00000150366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062380] [ENSMUST00000206463] [ENSMUST00000216415]
Predicted Effect probably benign
Transcript: ENSMUST00000062380
AA Change: I150K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056448
Gene: ENSMUSG00000047960
AA Change: I150K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.4e-49 PFAM
Pfam:7tm_1 41 290 7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205894
Predicted Effect probably benign
Transcript: ENSMUST00000206463
AA Change: I150K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000216415
AA Change: I150K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pnpla6 C T 8: 3,521,572 L168F probably benign Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Olfr186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Olfr186 APN 16 59027853 missense probably benign 0.00
IGL00969:Olfr186 APN 16 59027631 missense possibly damaging 0.48
IGL01102:Olfr186 APN 16 59027829 missense probably benign 0.03
IGL01348:Olfr186 APN 16 59027794 missense probably damaging 1.00
IGL01399:Olfr186 APN 16 59027266 missense probably benign 0.05
IGL02088:Olfr186 APN 16 59027052 missense probably damaging 1.00
R0047:Olfr186 UTSW 16 59027224 missense probably benign 0.00
R0479:Olfr186 UTSW 16 59027128 missense possibly damaging 0.64
R0866:Olfr186 UTSW 16 59027428 missense probably benign
R0926:Olfr186 UTSW 16 59027688 missense possibly damaging 0.80
R1760:Olfr186 UTSW 16 59026987 missense probably benign 0.01
R1955:Olfr186 UTSW 16 59027411 missense probably damaging 0.99
R2085:Olfr186 UTSW 16 59027869 missense probably benign 0.02
R2118:Olfr186 UTSW 16 59027815 missense possibly damaging 0.78
R4156:Olfr186 UTSW 16 59027568 missense probably damaging 1.00
R4287:Olfr186 UTSW 16 59027613 missense probably benign 0.00
R4783:Olfr186 UTSW 16 59027897 missense probably benign
R4885:Olfr186 UTSW 16 59027155 missense probably damaging 1.00
R4947:Olfr186 UTSW 16 59027445 missense probably damaging 0.98
R4965:Olfr186 UTSW 16 59027333 missense probably damaging 1.00
R7624:Olfr186 UTSW 16 59027019 missense possibly damaging 0.80
R7683:Olfr186 UTSW 16 59027106 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTGAATACCTGTATTGAACCAGAC -3'
(R):5'- GCAGTGACTCCTAATATGTTGTTTG -3'

Sequencing Primer
(F):5'- TTAAGAGTAGGATCAGTACAGGA -3'
(R):5'- GAACAAGATGATATCACTTTCCGAG -3'
Posted On2018-04-02