Incidental Mutation 'R6314:Pnpla6'
ID509940
Institutional Source Beutler Lab
Gene Symbol Pnpla6
Ensembl Gene ENSMUSG00000004565
Gene Namepatatin-like phospholipase domain containing 6
SynonymsNte, Swiss-cheese, MSws
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6314 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3515384-3544267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3521572 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 168 (L168F)
Ref Sequence ENSEMBL: ENSMUSP00000106699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004681] [ENSMUST00000111070] [ENSMUST00000207146] [ENSMUST00000207424] [ENSMUST00000207941] [ENSMUST00000208002] [ENSMUST00000208310] [ENSMUST00000208762]
Predicted Effect probably benign
Transcript: ENSMUST00000004681
AA Change: L168F

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004681
Gene: ENSMUSG00000004565
AA Change: L168F

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111070
AA Change: L168F

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106699
Gene: ENSMUSG00000004565
AA Change: L168F

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
cNMP 147 272 3.17e-13 SMART
cNMP 465 584 3.17e-4 SMART
cNMP 587 703 3.45e-5 SMART
Blast:cNMP 742 777 7e-11 BLAST
Pfam:Patatin 933 1099 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207146
Predicted Effect probably benign
Transcript: ENSMUST00000207424
AA Change: L168F

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207430
Predicted Effect probably benign
Transcript: ENSMUST00000207941
AA Change: L200F

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000208002
AA Change: L190F

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208006
Predicted Effect probably benign
Transcript: ENSMUST00000208310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208315
Predicted Effect probably benign
Transcript: ENSMUST00000208762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208851
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase that deacetylates intracellular phosphatidylcholine to produce glycerophosphocholine. It is thought to function in neurite outgrowth and process elongation during neuronal differentiation. The protein is anchored to the cytoplasmic face of the endoplasmic reticulum in both neurons and non-neuronal cells. Mutations in this gene result in autosomal recessive spastic paraplegia, and the protein is the target for neurodegeneration induced by organophosphorus compounds and chemical warfare agents. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during early gestation. Conditional inactivation in the central nervous system leads to neurodegeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T C 2: 85,502,176 N168S probably benign Het
4930449I24Rik A C 5: 146,504,892 E283A possibly damaging Het
6430531B16Rik A C 7: 139,976,489 L195R possibly damaging Het
9130204L05Rik A T 3: 91,088,376 V73E possibly damaging Het
Aadacl2 A T 3: 60,017,403 R130S probably damaging Het
Adam22 A T 5: 8,127,365 C581* probably null Het
Adss T A 1: 177,767,768 Y402F probably damaging Het
Agfg1 A T 1: 82,858,434 Q13H probably damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Armc8 A G 9: 99,535,884 S74P probably benign Het
Atn1 A T 6: 124,747,050 probably benign Het
BC027072 T G 17: 71,752,457 Q75P probably benign Het
Ddx5 T C 11: 106,788,521 probably benign Het
Depdc1a T A 3: 159,498,414 H33Q probably damaging Het
Dnmt3l A T 10: 78,059,687 Y58F probably benign Het
Efemp1 C T 11: 28,914,603 T219I probably benign Het
Enpp2 T C 15: 54,865,970 N436D probably damaging Het
Epb41l4a A G 18: 33,874,155 V261A probably damaging Het
Erap1 A T 13: 74,674,775 K802N probably damaging Het
Fcrl6 T A 1: 172,598,619 probably null Het
Fv1 A T 4: 147,869,699 probably null Het
Gdpd4 T A 7: 97,973,953 M257K probably damaging Het
Gorab T C 1: 163,397,089 S48G probably damaging Het
Gxylt2 A T 6: 100,798,203 H361L probably damaging Het
Hk1 A G 10: 62,292,444 Y300H possibly damaging Het
Hk3 T C 13: 55,013,580 R156G probably benign Het
Hook3 T A 8: 26,088,108 M118L probably benign Het
Lmnb2 G A 10: 80,909,970 R92C probably damaging Het
Lsr A G 7: 30,958,599 L380P probably damaging Het
Mettl16 A T 11: 74,796,006 R204* probably null Het
Olfr1353 A G 10: 78,970,345 H232R probably benign Het
Olfr186 A T 16: 59,027,457 I150K probably benign Het
Olfr866 C A 9: 20,027,662 S92I probably damaging Het
Orc3 C A 4: 34,579,797 G494C possibly damaging Het
Pip5k1a G T 3: 95,068,121 T346K probably damaging Het
Pitx1 A T 13: 55,826,353 S222T possibly damaging Het
Pm20d1 T C 1: 131,816,016 V473A possibly damaging Het
Pramef12 T C 4: 144,394,587 D289G probably damaging Het
Reln C A 5: 22,152,484 E195* probably null Het
Sec24b A T 3: 130,007,245 probably null Het
Selenbp1 A G 3: 94,937,265 N78D probably damaging Het
Serpina1d T A 12: 103,764,700 T340S probably benign Het
Slc13a2 CGTTATCTGT CGT 11: 78,403,480 probably benign Het
Snap29 T C 16: 17,419,319 M98T probably benign Het
Son G T 16: 91,660,410 probably benign Het
Tgfbi A T 13: 56,626,163 T252S probably benign Het
Thsd7a T C 6: 12,554,997 N296S possibly damaging Het
Tmem225 C G 9: 40,150,720 T210S probably benign Het
Tmem245 A T 4: 56,888,592 V778D possibly damaging Het
Tor4a T C 2: 25,194,782 R370G possibly damaging Het
Tubgcp3 T C 8: 12,648,625 H442R probably benign Het
Vmn1r20 A T 6: 57,432,057 M123L probably benign Het
Zfp622 T C 15: 25,986,981 V273A probably benign Het
Zhx1 C T 15: 58,054,002 V283I probably benign Het
Other mutations in Pnpla6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pnpla6 APN 8 3523808 missense probably damaging 1.00
IGL00820:Pnpla6 APN 8 3532358 missense possibly damaging 0.95
IGL00839:Pnpla6 APN 8 3542299 missense probably benign 0.05
IGL01732:Pnpla6 APN 8 3522616 missense probably damaging 0.99
IGL01973:Pnpla6 APN 8 3517619 missense probably damaging 1.00
IGL02267:Pnpla6 APN 8 3517327 missense probably benign 0.00
IGL03246:Pnpla6 APN 8 3531530 missense probably benign 0.01
IGL03286:Pnpla6 APN 8 3531473 missense probably damaging 0.99
I0000:Pnpla6 UTSW 8 3542322 missense probably benign
R0141:Pnpla6 UTSW 8 3532117 critical splice donor site probably null
R0180:Pnpla6 UTSW 8 3524250 critical splice acceptor site probably null
R0377:Pnpla6 UTSW 8 3541501 missense probably damaging 1.00
R0563:Pnpla6 UTSW 8 3523333 missense possibly damaging 0.51
R0660:Pnpla6 UTSW 8 3522269 unclassified probably benign
R0786:Pnpla6 UTSW 8 3523317 missense probably benign
R0827:Pnpla6 UTSW 8 3517618 missense possibly damaging 0.71
R0882:Pnpla6 UTSW 8 3517081 missense probably damaging 1.00
R1512:Pnpla6 UTSW 8 3535459 splice site probably benign
R1552:Pnpla6 UTSW 8 3522403 missense probably damaging 1.00
R1609:Pnpla6 UTSW 8 3517135 missense probably damaging 1.00
R1770:Pnpla6 UTSW 8 3534634 missense possibly damaging 0.94
R1779:Pnpla6 UTSW 8 3541404 missense probably damaging 1.00
R1987:Pnpla6 UTSW 8 3542370 missense probably benign 0.00
R3079:Pnpla6 UTSW 8 3541512 missense probably benign 0.25
R3125:Pnpla6 UTSW 8 3534670 missense probably null 1.00
R4171:Pnpla6 UTSW 8 3543997 missense probably benign 0.09
R4281:Pnpla6 UTSW 8 3521513 missense probably damaging 1.00
R4674:Pnpla6 UTSW 8 3521412 missense probably damaging 1.00
R4776:Pnpla6 UTSW 8 3523818 missense probably benign 0.01
R4779:Pnpla6 UTSW 8 3522838 missense probably benign 0.00
R5114:Pnpla6 UTSW 8 3522613 missense probably damaging 0.98
R5459:Pnpla6 UTSW 8 3535829 missense probably benign 0.01
R5510:Pnpla6 UTSW 8 3521397 missense probably damaging 0.99
R5538:Pnpla6 UTSW 8 3531508 missense probably benign 0.01
R5664:Pnpla6 UTSW 8 3537478 missense probably damaging 0.98
R6063:Pnpla6 UTSW 8 3524156 missense probably benign 0.21
R6321:Pnpla6 UTSW 8 3544015 missense probably benign
R6454:Pnpla6 UTSW 8 3537986 missense probably damaging 0.99
R6477:Pnpla6 UTSW 8 3536627 missense probably benign 0.00
R6524:Pnpla6 UTSW 8 3534519 splice site probably null
R6809:Pnpla6 UTSW 8 3534611 missense possibly damaging 0.72
R6975:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7293:Pnpla6 UTSW 8 3538068 missense probably damaging 1.00
R7389:Pnpla6 UTSW 8 3543981 nonsense probably null
R7426:Pnpla6 UTSW 8 3516540 utr 5 prime probably null
R7520:Pnpla6 UTSW 8 3537508 missense probably damaging 1.00
R7666:Pnpla6 UTSW 8 3541591 missense probably benign 0.01
R7733:Pnpla6 UTSW 8 3522660 missense probably benign 0.01
R7743:Pnpla6 UTSW 8 3536594 missense possibly damaging 0.77
R7744:Pnpla6 UTSW 8 3531677 missense probably benign 0.38
X0018:Pnpla6 UTSW 8 3517337 missense probably damaging 1.00
Z1177:Pnpla6 UTSW 8 3536979 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GCTTAAGAATGTTCGGTAAGTGTC -3'
(R):5'- ACATAACAGGCAAGTACTGGAC -3'

Sequencing Primer
(F):5'- AATGTTCGGTAAGTGTCGGGGAC -3'
(R):5'- GGATTCTAGACAGAGGCCCTAC -3'
Posted On2018-04-02