Incidental Mutation 'R6334:Zfp553'
ID 510706
Institutional Source Beutler Lab
Gene Symbol Zfp553
Ensembl Gene ENSMUSG00000045598
Gene Name zinc finger protein 553
Synonyms C330013F15Rik, ENSMUSG00000054461, 2600009K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6334 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127233061-127238179 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 127236892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056232] [ENSMUST00000106312] [ENSMUST00000133913]
AlphaFold Q3US17
Predicted Effect probably damaging
Transcript: ENSMUST00000056232
AA Change: G540W

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060967
Gene: ENSMUSG00000045598
AA Change: G540W

DomainStartEndE-ValueType
ZnF_C2H2 83 105 5.9e-3 SMART
ZnF_C2H2 111 133 6.32e-3 SMART
low complexity region 140 155 N/A INTRINSIC
ZnF_C2H2 163 185 4.17e-3 SMART
ZnF_C2H2 191 213 5.5e-3 SMART
low complexity region 219 239 N/A INTRINSIC
ZnF_C2H2 246 268 1.45e-2 SMART
ZnF_C2H2 274 296 4.17e-3 SMART
ZnF_C2H2 302 324 3.89e-3 SMART
ZnF_C2H2 330 352 1.36e-2 SMART
low complexity region 364 392 N/A INTRINSIC
low complexity region 394 419 N/A INTRINSIC
ZnF_C2H2 423 445 3.21e-4 SMART
ZnF_C2H2 451 473 3.89e-3 SMART
low complexity region 477 494 N/A INTRINSIC
ZnF_C2H2 516 538 9.08e-4 SMART
ZnF_C2H2 544 566 5.42e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106312
AA Change: G540W

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101919
Gene: ENSMUSG00000045598
AA Change: G540W

DomainStartEndE-ValueType
ZnF_C2H2 83 105 5.9e-3 SMART
ZnF_C2H2 111 133 6.32e-3 SMART
low complexity region 140 155 N/A INTRINSIC
ZnF_C2H2 163 185 4.17e-3 SMART
ZnF_C2H2 191 213 5.5e-3 SMART
low complexity region 219 239 N/A INTRINSIC
ZnF_C2H2 246 268 1.45e-2 SMART
ZnF_C2H2 274 296 4.17e-3 SMART
ZnF_C2H2 302 324 3.89e-3 SMART
ZnF_C2H2 330 352 1.36e-2 SMART
low complexity region 364 392 N/A INTRINSIC
low complexity region 394 419 N/A INTRINSIC
ZnF_C2H2 423 445 3.21e-4 SMART
ZnF_C2H2 451 473 3.89e-3 SMART
low complexity region 477 494 N/A INTRINSIC
ZnF_C2H2 516 538 9.08e-4 SMART
ZnF_C2H2 544 566 5.42e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000133913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205570
Meta Mutation Damage Score 0.3609 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,114 S141T probably benign Het
Afap1l2 A G 19: 56,917,976 probably null Het
Aox2 C T 1: 58,307,407 Q567* probably null Het
Aqp4 T A 18: 15,393,591 M278L probably benign Het
Atp23 A C 10: 126,887,669 L188R probably benign Het
B230359F08Rik A G 14: 53,795,942 T103A probably damaging Het
Catsperg1 C T 7: 29,206,357 G215D probably benign Het
Cavin4 T C 4: 48,663,824 V68A possibly damaging Het
Ccl4 T C 11: 83,662,678 S6P unknown Het
Cfap46 T C 7: 139,680,831 E117G probably damaging Het
Chek1 A G 9: 36,714,492 S286P possibly damaging Het
Cntn4 G A 6: 106,344,786 V35I probably benign Het
Cntn4 C A 6: 106,506,192 P236Q probably benign Het
Cyp2d40 C A 15: 82,761,552 G84V probably benign Het
Dnah12 A T 14: 26,706,834 H205L possibly damaging Het
Dock1 G A 7: 134,851,576 V845I probably benign Het
Drg1 T C 11: 3,266,292 K7E possibly damaging Het
Eloa G A 4: 136,009,822 P488S probably damaging Het
Evi5 G A 5: 107,820,521 R187* probably null Het
Fam53a T A 5: 33,600,875 L301F probably damaging Het
Fmnl3 T C 15: 99,337,653 K63E probably damaging Het
Gast C A 11: 100,336,612 Q44K probably benign Het
Gm4788 A G 1: 139,773,924 probably null Het
Gng10 T A 4: 59,035,257 V7E probably benign Het
Gtf3c5 G A 2: 28,570,462 T375I probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hspa14 A T 2: 3,489,072 probably null Het
Kcna3 T C 3: 107,036,424 M1T probably null Het
Kcnj15 T G 16: 95,296,236 L239R probably damaging Het
Klhl2 G T 8: 64,759,808 D232E probably benign Het
Lamb3 A T 1: 193,335,474 I888F probably damaging Het
Lars C A 18: 42,217,486 M919I probably benign Het
Lfng T C 5: 140,612,767 V247A possibly damaging Het
Lrp1b C T 2: 41,789,033 A16T probably benign Het
Mamdc2 A T 19: 23,363,906 I235N probably damaging Het
Map9 T A 3: 82,383,305 L492Q probably damaging Het
Mcpt8 A G 14: 56,085,147 V14A possibly damaging Het
Myo1b T C 1: 51,768,651 K823R probably null Het
Nbea G T 3: 56,037,149 T598K probably damaging Het
Nrcam C A 12: 44,572,300 H877N probably benign Het
Nrxn2 T C 19: 6,531,292 probably null Het
Nwd2 A T 5: 63,800,253 I309F possibly damaging Het
Phyhd1 G A 2: 30,274,724 probably null Het
Pkp2 C T 16: 16,226,069 T229I probably damaging Het
Plagl2 G A 2: 153,232,691 P97S probably benign Het
Plekhh2 C A 17: 84,566,866 N526K probably benign Het
Plin4 A G 17: 56,103,261 L1217P probably benign Het
Polr3e T C 7: 120,927,999 S67P possibly damaging Het
Postn A G 3: 54,385,282 K757E probably benign Het
Prpf39 T A 12: 65,042,813 probably null Het
Ptprg C T 14: 12,166,832 T745I probably damaging Het
Pxylp1 C G 9: 96,825,254 A292P probably damaging Het
Rpl35 G T 2: 39,001,742 D82E possibly damaging Het
Slc9a1 G A 4: 133,422,208 V782I possibly damaging Het
Syn2 T A 6: 115,263,914 M415K possibly damaging Het
Tmem117 A C 15: 95,011,443 I246L probably benign Het
Tmem221 A T 8: 71,558,784 V9E probably damaging Het
Ubxn7 T A 16: 32,372,189 probably null Het
Vmn2r101 G T 17: 19,589,850 M299I possibly damaging Het
Vmn2r103 T A 17: 19,794,082 S379T probably damaging Het
Vmn2r109 T C 17: 20,541,178 N639S probably benign Het
Wdr26 T C 1: 181,203,206 Het
Zfp109 T A 7: 24,228,883 Y367F probably damaging Het
Zfp143 G A 7: 110,086,131 C389Y probably damaging Het
Other mutations in Zfp553
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Zfp553 APN 7 127236215 missense probably damaging 1.00
IGL01528:Zfp553 APN 7 127236215 missense probably damaging 1.00
IGL03228:Zfp553 APN 7 127236077 missense probably damaging 1.00
R1051:Zfp553 UTSW 7 127236805 nonsense probably null
R1859:Zfp553 UTSW 7 127235345 missense probably benign 0.04
R1899:Zfp553 UTSW 7 127235654 missense possibly damaging 0.66
R4997:Zfp553 UTSW 7 127235511 missense probably benign 0.15
R5090:Zfp553 UTSW 7 127235487 missense probably damaging 0.98
R5282:Zfp553 UTSW 7 127236841 missense probably benign 0.12
R5468:Zfp553 UTSW 7 127237030 missense probably benign
R5576:Zfp553 UTSW 7 127236703 missense possibly damaging 0.80
R6828:Zfp553 UTSW 7 127236275 missense probably damaging 1.00
R6974:Zfp553 UTSW 7 127236653 missense probably damaging 1.00
R7149:Zfp553 UTSW 7 127236433 missense possibly damaging 0.94
R7615:Zfp553 UTSW 7 127236016 missense probably damaging 1.00
R7922:Zfp553 UTSW 7 127236596 missense probably damaging 0.99
R8103:Zfp553 UTSW 7 127236764 missense probably benign
R8111:Zfp553 UTSW 7 127236921 nonsense probably null
R8199:Zfp553 UTSW 7 127236296 missense probably damaging 1.00
R8390:Zfp553 UTSW 7 127236304 missense probably damaging 1.00
Z1088:Zfp553 UTSW 7 127235498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTGCCCGAGTCAAACAC -3'
(R):5'- GCGCCTAACCAAGACAGTTTC -3'

Sequencing Primer
(F):5'- GGCGAACGCACTAGACC -3'
(R):5'- CAAGACAGTTTCCTGAGCATG -3'
Posted On 2018-04-02