Mutagenetix > Incidental Mutation

Incidental Mutation 'R6334:Vmn2r109'

510730

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r109

Ensembl Gene

ENSMUSG00000090572

Gene Name

vomeronasal 2, receptor 109

Synonyms

EG627814

MMRRC Submission

044488-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R6334 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20540517-20564756 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20541178 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 639 (N639S)

Ref Sequence

ENSEMBL: ENSMUSP00000132641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167093]

AlphaFold

K7N747

Predicted Effect

probably benign
Transcript: ENSMUST00000167093
AA Change: N639S

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: N639S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	467	1.4e-35	PFAM
Pfam:NCD3G	510	563	3.1e-21	PFAM
Pfam:7tm_3	596	831	7.4e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (64/64)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	T	A	11: 58,880,114	S141T	probably benign	Het
Afap1l2	A	G	19: 56,917,976		probably null	Het
Aox2	C	T	1: 58,307,407	Q567*	probably null	Het
Aqp4	T	A	18: 15,393,591	M278L	probably benign	Het
Atp23	A	C	10: 126,887,669	L188R	probably benign	Het
B230359F08Rik	A	G	14: 53,795,942	T103A	probably damaging	Het
Catsperg1	C	T	7: 29,206,357	G215D	probably benign	Het
Cavin4	T	C	4: 48,663,824	V68A	possibly damaging	Het
Ccl4	T	C	11: 83,662,678	S6P	unknown	Het
Cfap46	T	C	7: 139,680,831	E117G	probably damaging	Het
Chek1	A	G	9: 36,714,492	S286P	possibly damaging	Het
Cntn4	G	A	6: 106,344,786	V35I	probably benign	Het
Cntn4	C	A	6: 106,506,192	P236Q	probably benign	Het
Cyp2d40	C	A	15: 82,761,552	G84V	probably benign	Het
Dnah12	A	T	14: 26,706,834	H205L	possibly damaging	Het
Dock1	G	A	7: 134,851,576	V845I	probably benign	Het
Drg1	T	C	11: 3,266,292	K7E	possibly damaging	Het
Eloa	G	A	4: 136,009,822	P488S	probably damaging	Het
Evi5	G	A	5: 107,820,521	R187*	probably null	Het
Fam53a	T	A	5: 33,600,875	L301F	probably damaging	Het
Fmnl3	T	C	15: 99,337,653	K63E	probably damaging	Het
Gast	C	A	11: 100,336,612	Q44K	probably benign	Het
Gm4788	A	G	1: 139,773,924		probably null	Het
Gng10	T	A	4: 59,035,257	V7E	probably benign	Het
Gtf3c5	G	A	2: 28,570,462	T375I	probably benign	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Hspa14	A	T	2: 3,489,072		probably null	Het
Kcna3	T	C	3: 107,036,424	M1T	probably null	Het
Kcnj15	T	G	16: 95,296,236	L239R	probably damaging	Het
Klhl2	G	T	8: 64,759,808	D232E	probably benign	Het
Lamb3	A	T	1: 193,335,474	I888F	probably damaging	Het
Lars	C	A	18: 42,217,486	M919I	probably benign	Het
Lfng	T	C	5: 140,612,767	V247A	possibly damaging	Het
Lrp1b	C	T	2: 41,789,033	A16T	probably benign	Het
Mamdc2	A	T	19: 23,363,906	I235N	probably damaging	Het
Map9	T	A	3: 82,383,305	L492Q	probably damaging	Het
Mcpt8	A	G	14: 56,085,147	V14A	possibly damaging	Het
Myo1b	T	C	1: 51,768,651	K823R	probably null	Het
Nbea	G	T	3: 56,037,149	T598K	probably damaging	Het
Nrcam	C	A	12: 44,572,300	H877N	probably benign	Het
Nrxn2	T	C	19: 6,531,292		probably null	Het
Nwd2	A	T	5: 63,800,253	I309F	possibly damaging	Het
Phyhd1	G	A	2: 30,274,724		probably null	Het
Pkp2	C	T	16: 16,226,069	T229I	probably damaging	Het
Plagl2	G	A	2: 153,232,691	P97S	probably benign	Het
Plekhh2	C	A	17: 84,566,866	N526K	probably benign	Het
Plin4	A	G	17: 56,103,261	L1217P	probably benign	Het
Polr3e	T	C	7: 120,927,999	S67P	possibly damaging	Het
Postn	A	G	3: 54,385,282	K757E	probably benign	Het
Prpf39	T	A	12: 65,042,813		probably null	Het
Ptprg	C	T	14: 12,166,832	T745I	probably damaging	Het
Pxylp1	C	G	9: 96,825,254	A292P	probably damaging	Het
Rpl35	G	T	2: 39,001,742	D82E	possibly damaging	Het
Slc9a1	G	A	4: 133,422,208	V782I	possibly damaging	Het
Syn2	T	A	6: 115,263,914	M415K	possibly damaging	Het
Tmem117	A	C	15: 95,011,443	I246L	probably benign	Het
Tmem221	A	T	8: 71,558,784	V9E	probably damaging	Het
Ubxn7	T	A	16: 32,372,189		probably null	Het
Vmn2r101	G	T	17: 19,589,850	M299I	possibly damaging	Het
Vmn2r103	T	A	17: 19,794,082	S379T	probably damaging	Het
Wdr26	T	C	1: 181,203,206			Het
Zfp109	T	A	7: 24,228,883	Y367F	probably damaging	Het
Zfp143	G	A	7: 110,086,131	C389Y	probably damaging	Het
Zfp553	G	T	7: 127,236,892		probably null	Het

Other mutations in Vmn2r109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01313:Vmn2r109	APN	17	20550157	missense	probably damaging	1.00
IGL01383:Vmn2r109	APN	17	20541121	missense	possibly damaging	0.89
IGL01469:Vmn2r109	APN	17	20541409	missense	probably damaging	1.00
IGL01762:Vmn2r109	APN	17	20554392	missense	probably benign
IGL01864:Vmn2r109	APN	17	20541134	missense	probably benign	0.28
IGL02028:Vmn2r109	APN	17	20541080	missense	probably benign	0.28
IGL02074:Vmn2r109	APN	17	20554341	missense	probably benign	0.05
IGL02162:Vmn2r109	APN	17	20554160	missense	probably benign	0.01
IGL02474:Vmn2r109	APN	17	20540888	missense	probably benign
IGL02490:Vmn2r109	APN	17	20540984	missense	possibly damaging	0.78
IGL02604:Vmn2r109	APN	17	20540701	missense	probably damaging	1.00
IGL02669:Vmn2r109	APN	17	20554256	missense	possibly damaging	0.64
IGL02705:Vmn2r109	APN	17	20553800	missense	probably benign
IGL02745:Vmn2r109	APN	17	20541250	missense	probably damaging	0.99
PIT4142001:Vmn2r109	UTSW	17	20554577	critical splice acceptor site	probably null
R0389:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R0470:Vmn2r109	UTSW	17	20552886	missense	probably benign	0.06
R0570:Vmn2r109	UTSW	17	20540675	missense	probably damaging	0.99
R0855:Vmn2r109	UTSW	17	20541408	nonsense	probably null
R0882:Vmn2r109	UTSW	17	20554580	splice site	probably benign
R1241:Vmn2r109	UTSW	17	20555241	missense	possibly damaging	0.86
R1587:Vmn2r109	UTSW	17	20540740	missense	probably damaging	1.00
R1931:Vmn2r109	UTSW	17	20553810	nonsense	probably null
R1957:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R1962:Vmn2r109	UTSW	17	20553923	missense	probably damaging	0.99
R2020:Vmn2r109	UTSW	17	20541186	nonsense	probably null
R2073:Vmn2r109	UTSW	17	20564712	missense	probably benign	0.00
R2436:Vmn2r109	UTSW	17	20554536	missense	probably damaging	0.99
R3123:Vmn2r109	UTSW	17	20540986	missense	probably damaging	1.00
R3839:Vmn2r109	UTSW	17	20554442	missense	probably damaging	1.00
R4019:Vmn2r109	UTSW	17	20553812	missense	probably benign
R4428:Vmn2r109	UTSW	17	20553024	missense	probably benign
R4584:Vmn2r109	UTSW	17	20554558	nonsense	probably null
R4652:Vmn2r109	UTSW	17	20541394	missense	probably damaging	1.00
R4708:Vmn2r109	UTSW	17	20541343	missense	probably damaging	0.97
R4823:Vmn2r109	UTSW	17	20553891	missense	probably damaging	1.00
R4831:Vmn2r109	UTSW	17	20541232	missense	probably benign	0.01
R4907:Vmn2r109	UTSW	17	20550086	missense	probably damaging	1.00
R5011:Vmn2r109	UTSW	17	20555189	missense	probably damaging	1.00
R5296:Vmn2r109	UTSW	17	20554341	missense	possibly damaging	0.90
R5600:Vmn2r109	UTSW	17	20540927	missense	probably damaging	1.00
R5602:Vmn2r109	UTSW	17	20540671	missense	possibly damaging	0.94
R5652:Vmn2r109	UTSW	17	20540519	makesense	probably null
R5702:Vmn2r109	UTSW	17	20554145	missense	probably benign	0.42
R5706:Vmn2r109	UTSW	17	20554305	missense	probably benign	0.16
R5714:Vmn2r109	UTSW	17	20552859	missense	probably damaging	1.00
R5832:Vmn2r109	UTSW	17	20541056	missense	probably benign	0.10
R6008:Vmn2r109	UTSW	17	20540719	missense	probably damaging	1.00
R6377:Vmn2r109	UTSW	17	20564534	critical splice donor site	probably null
R6738:Vmn2r109	UTSW	17	20554523	missense	possibly damaging	0.52
R6857:Vmn2r109	UTSW	17	20540670	missense	probably benign	0.45
R6953:Vmn2r109	UTSW	17	20540711	missense	possibly damaging	0.95
R7108:Vmn2r109	UTSW	17	20564744	missense	probably benign	0.03
R7229:Vmn2r109	UTSW	17	20540963	missense	possibly damaging	0.80
R7238:Vmn2r109	UTSW	17	20541074	missense	probably damaging	1.00
R7244:Vmn2r109	UTSW	17	20540683	missense	possibly damaging	0.70
R7292:Vmn2r109	UTSW	17	20541438	missense	probably benign	0.05
R7354:Vmn2r109	UTSW	17	20540781	missense	probably damaging	1.00
R7357:Vmn2r109	UTSW	17	20541274	missense	probably damaging	1.00
R7522:Vmn2r109	UTSW	17	20554403	missense	probably benign	0.11
R7596:Vmn2r109	UTSW	17	20540680	missense	probably damaging	0.98
R7728:Vmn2r109	UTSW	17	20552855	missense	probably damaging	0.99
R7859:Vmn2r109	UTSW	17	20541174	missense	probably damaging	1.00
R7871:Vmn2r109	UTSW	17	20540520	missense	probably benign	0.08
R8113:Vmn2r109	UTSW	17	20554467	missense	probably benign	0.01
R8153:Vmn2r109	UTSW	17	20564707	missense	probably benign	0.11
R8977:Vmn2r109	UTSW	17	20554269	missense	possibly damaging	0.96
R9687:Vmn2r109	UTSW	17	20555070	missense
Z1176:Vmn2r109	UTSW	17	20552994	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGTTGCCATCCATATTCCACAAAG -3'
(R):5'- TCTGTCCTACAAAGACCCGTTG -3'

Sequencing Primer
(F):5'- CCATATTCCACAAAGAAGAAGTTGG -3'
(R):5'- TTGGGGGTGACACTAGCCAAC -3'

Posted On

2018-04-02