Mutagenetix > Incidental Mutations

Incidental Mutation 'R6669:Gpat2'

528048

Institutional Source

Beutler Lab

Gene Symbol

Gpat2

Ensembl Gene

ENSMUSG00000046338

Gene Name

glycerol-3-phosphate acyltransferase 2, mitochondrial

Synonyms

Gpat2, A530057A03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6669 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127425199-127436092 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 127431918 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 294 (G294R)

Ref Sequence

ENSEMBL: ENSMUSP00000049619 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028848] [ENSMUST00000062211]

Predicted Effect

probably benign
Transcript: ENSMUST00000028848

SMART Domains

Protein: ENSMUSP00000028848
Gene: ENSMUSG00000027371

Domain	Start	End	E-Value	Type
low complexity region	47	53	N/A	INTRINSIC
Pfam:FAA_hydrolase	107	313	3.1e-75	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000062211
AA Change: G294R

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000049619
Gene: ENSMUSG00000046338
AA Change: G294R

Domain	Start	End	E-Value	Type
PlsC	199	333	1.45e-11	SMART
Blast:PlsC	347	387	7e-13	BLAST
low complexity region	431	468	N/A	INTRINSIC
low complexity region	515	528	N/A	INTRINSIC
low complexity region	593	613	N/A	INTRINSIC
low complexity region	664	675	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123327

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137366

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146757

Meta Mutation Damage Score

0.3984

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.5%

Validation Efficiency

97% (33/34)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ascc3	A	G	10: 50,840,373	I1952V	probably benign	Het
Atg2b	T	C	12: 105,671,529	E142G	possibly damaging	Het
Bbc3	G	T	7: 16,313,716	A122S	possibly damaging	Het
Cenpu	T	C	8: 46,576,284	S191P	probably damaging	Het
Clic3	G	T	2: 25,457,767	R48L	possibly damaging	Het
Cmya5	T	C	13: 93,093,259	K1774E	probably benign	Het
Cnst	T	A	1: 179,605,073		probably null	Het
Cyfip1	T	A	7: 55,900,061	S657T	probably damaging	Het
Dock10	T	C	1: 80,592,855	Y322C	probably damaging	Het
Epn2	C	T	11: 61,519,558	V550I	probably benign	Het
Evc2	C	T	5: 37,378,378	P466S	possibly damaging	Het
Fancd2	C	T	6: 113,593,327	T1413I	probably benign	Het
Herc4	T	A	10: 63,286,068	W400R	probably benign	Het
Kcna7	T	C	7: 45,409,564	V425A	probably damaging	Het
Klhl3	A	T	13: 58,011,152	D564E	probably benign	Het
Man2b2	T	C	5: 36,810,358	I889V	probably benign	Het
Mcm3ap	A	G	10: 76,507,337	I1688V	probably damaging	Het
Mocos	T	A	18: 24,666,410	F234I	probably damaging	Het
Muc20	T	C	16: 32,793,937	T357A	possibly damaging	Het
Ncoa6	T	G	2: 155,399,693		probably null	Het
Nlk	C	A	11: 78,587,066	G284*	probably null	Het
Nrxn1	T	A	17: 90,059,563	T12S	probably damaging	Het
Nrxn2	A	G	19: 6,481,191	Y627C	probably damaging	Het
Ntn1	T	C	11: 68,385,750	N124S	probably benign	Het
Pdzd7	T	A	19: 45,036,751	Q435L	possibly damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Slc30a10	G	A	1: 185,464,428	R429Q	probably benign	Het
Tox4	T	C	14: 52,286,756	Y116H	probably damaging	Het
Trpv5	G	A	6: 41,658,042	A451V	probably damaging	Het
Ube3a	T	C	7: 59,276,857	V482A	probably benign	Het
Vcan	A	T	13: 89,704,731	D703E	probably benign	Het
Xirp2	C	A	2: 67,513,355	A1980E	possibly damaging	Het
Xrcc1	T	C	7: 24,547,337	V10A	probably damaging	Het

Other mutations in Gpat2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Gpat2	APN	2	127432396	missense	probably benign	0.01
IGL00479:Gpat2	APN	2	127434461	missense	probably damaging	0.99
IGL01393:Gpat2	APN	2	127432651	missense	probably damaging	1.00
IGL01759:Gpat2	APN	2	127430896	missense	possibly damaging	0.94
IGL01764:Gpat2	APN	2	127427536	missense	probably benign	0.18
IGL02631:Gpat2	APN	2	127434232	splice site	probably benign
IGL02657:Gpat2	APN	2	127427331	missense	probably benign	0.04
IGL02813:Gpat2	APN	2	127434455	missense	possibly damaging	0.90
IGL02873:Gpat2	APN	2	127431755	missense	probably benign	0.00
IGL02993:Gpat2	APN	2	127427566	missense	probably damaging	1.00
R6669_gpat2_048	UTSW	2	127431918	missense	possibly damaging	0.90
PIT4494001:Gpat2	UTSW	2	127433880	missense	probably benign	0.00
R0078:Gpat2	UTSW	2	127428249	missense	probably damaging	1.00
R0230:Gpat2	UTSW	2	127435845	missense	possibly damaging	0.95
R1619:Gpat2	UTSW	2	127428717	missense	probably benign	0.00
R1851:Gpat2	UTSW	2	127434819	missense	possibly damaging	0.77
R1939:Gpat2	UTSW	2	127435959	makesense	probably null
R2143:Gpat2	UTSW	2	127433762	missense	probably damaging	1.00
R2165:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R2518:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3410:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3411:Gpat2	UTSW	2	127428291	missense	probably damaging	0.97
R3898:Gpat2	UTSW	2	127435098	missense	probably damaging	1.00
R4080:Gpat2	UTSW	2	127433622	missense	probably damaging	0.99
R4725:Gpat2	UTSW	2	127431982	missense	possibly damaging	0.83
R4841:Gpat2	UTSW	2	127433967	missense	probably benign	0.10
R5354:Gpat2	UTSW	2	127428723	missense	probably damaging	1.00
R5941:Gpat2	UTSW	2	127428275	missense	possibly damaging	0.53
R6362:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6374:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6375:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6377:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6380:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6381:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6382:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6383:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6384:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6393:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6565:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6594:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6595:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6649:Gpat2	UTSW	2	127432435	missense	possibly damaging	0.81
R6665:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6666:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6667:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R6668:Gpat2	UTSW	2	127431918	missense	possibly damaging	0.90
R7031:Gpat2	UTSW	2	127435475	missense	probably damaging	0.99
R7096:Gpat2	UTSW	2	127428289	missense	probably benign	0.02
R7307:Gpat2	UTSW	2	127434890	missense	probably damaging	1.00
R7313:Gpat2	UTSW	2	127428295	missense	probably damaging	0.99
R7365:Gpat2	UTSW	2	127426981	intron	probably null

Predicted Primers

PCR Primer
(F):5'- AACTCAGAGGGCATCCTTGC -3'
(R):5'- AACATTGTGCCACCCAGAACTG -3'

Sequencing Primer
(F):5'- CATCCTTGCAAGGGCTGTG -3'
(R):5'- GGTTGATAATCTACTCGGATCCCAG -3'

Posted On

2018-07-24