Incidental Mutation 'R6501:Olfr1294'
ID519716
Institutional Source Beutler Lab
Gene Symbol Olfr1294
Ensembl Gene ENSMUSG00000109547
Gene Nameolfactory receptor 1294
SynonymsGA_x6K02T2Q125-72589785-72588847, MOR248-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111536530-111540291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111537779 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 170 (G170D)
Ref Sequence ENSEMBL: ENSMUSP00000146438 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000208334
AA Change: G170D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208675
AA Change: G170D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215245
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Olfr1294
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Olfr1294 APN 2 111538014 missense probably damaging 1.00
IGL02304:Olfr1294 APN 2 111537401 missense probably benign 0.06
IGL02555:Olfr1294 APN 2 111537917 missense probably damaging 0.98
R0422:Olfr1294 UTSW 2 111537983 missense probably damaging 0.97
R0647:Olfr1294 UTSW 2 111537359 missense probably benign 0.00
R0656:Olfr1294 UTSW 2 111537627 missense probably damaging 1.00
R1543:Olfr1294 UTSW 2 111537797 missense probably benign 0.00
R1909:Olfr1294 UTSW 2 111538014 missense probably damaging 1.00
R3735:Olfr1294 UTSW 2 111537896 missense probably damaging 1.00
R4671:Olfr1294 UTSW 2 111537935 missense probably damaging 1.00
R4703:Olfr1294 UTSW 2 111537768 missense probably benign 0.03
R4809:Olfr1294 UTSW 2 111537611 missense probably benign 0.15
R4822:Olfr1294 UTSW 2 111537452 missense probably damaging 0.98
R4837:Olfr1294 UTSW 2 111537974 missense probably damaging 0.98
R4880:Olfr1294 UTSW 2 111537353 nonsense probably null
R5203:Olfr1294 UTSW 2 111537636 missense probably damaging 1.00
R5871:Olfr1294 UTSW 2 111537639 missense probably damaging 1.00
R5902:Olfr1294 UTSW 2 111537394 missense probably benign 0.00
R7354:Olfr1294 UTSW 2 111537564 missense possibly damaging 0.94
Z1088:Olfr1294 UTSW 2 111537814 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGTGCAAGTGTTCATTGCCTTAG -3'
(R):5'- TTGCTGCAGGAGAAATGGTG -3'

Sequencing Primer
(F):5'- GCCTTAGATGCACCAGCTTTAGAG -3'
(R):5'- CTGCAGGAGAAATGGTGCTGTTG -3'
Posted On2018-06-06