Incidental Mutation 'R6535:Mettl8'
ID520322
Institutional Source Beutler Lab
Gene Symbol Mettl8
Ensembl Gene ENSMUSG00000041975
Gene Namemethyltransferase like 8
SynonymsTIP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.823) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70964561-71055583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70973389 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 185 (H185N)
Ref Sequence ENSEMBL: ENSMUSP00000097615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100037] [ENSMUST00000112179] [ENSMUST00000112186] [ENSMUST00000121586] [ENSMUST00000148876] [ENSMUST00000149181]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100037
AA Change: H185N

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097615
Gene: ENSMUSG00000041975
AA Change: H185N

DomainStartEndE-ValueType
Pfam:Methyltransf_23 115 304 1.4e-14 PFAM
Pfam:Ubie_methyltran 126 265 1.4e-7 PFAM
Pfam:Methyltransf_31 137 304 5.6e-10 PFAM
Pfam:Methyltransf_26 140 251 4.2e-8 PFAM
Pfam:Methyltransf_25 143 246 5.3e-13 PFAM
Pfam:Methyltransf_12 144 248 1e-12 PFAM
Pfam:Methyltransf_11 144 250 7.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112179
SMART Domains Protein: ENSMUSP00000107800
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
low complexity region 190 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112186
AA Change: H232N

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107804
Gene: ENSMUSG00000041975
AA Change: H232N

DomainStartEndE-ValueType
Pfam:Methyltransf_23 158 349 5.1e-15 PFAM
Pfam:Ubie_methyltran 173 312 8.7e-8 PFAM
Pfam:Methyltransf_31 184 348 3.7e-9 PFAM
Pfam:Methyltransf_25 190 293 3.9e-13 PFAM
Pfam:Methyltransf_12 191 295 7e-13 PFAM
Pfam:Methyltransf_11 191 297 6.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121586
AA Change: H232N

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113642
Gene: ENSMUSG00000041975
AA Change: H232N

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 279 1.4e-6 PFAM
Pfam:Methyltransf_11 191 280 5.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124781
Predicted Effect probably benign
Transcript: ENSMUST00000140293
SMART Domains Protein: ENSMUSP00000118026
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
Pfam:Methyltransf_11 2 66 2.2e-8 PFAM
Pfam:Methyltransf_23 3 109 6.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148876
AA Change: H232N

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115855
Gene: ENSMUSG00000041975
AA Change: H232N

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 281 1.9e-8 PFAM
Pfam:Methyltransf_11 191 280 2.8e-8 PFAM
Predicted Effect silent
Transcript: ENSMUST00000149181
SMART Domains Protein: ENSMUSP00000119863
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
SCOP:d1af7_2 107 137 7e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This locus encodes a member of the methyltransferase family, and is involved in chromatin remodeling. Transcripts from this locus can be induced or inhibited by cell stretch and affect cell differentiation in the myogenic or adipogenic pathways. Multiple transcript variants encoding different isoforms have been found for this gene. Additional splice variants have been described in the literature but they meet nonsense-mediated decay (NMD) criteria and are likely to be degraded as soon as they are transcribed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced 3-methylcytidine (m3C) methyltransferases modification of mRNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Mettl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Mettl8 APN 2 70982090 missense probably damaging 1.00
IGL01370:Mettl8 APN 2 70982039 missense probably damaging 1.00
R1709:Mettl8 UTSW 2 70982151 missense probably benign 0.02
R1944:Mettl8 UTSW 2 70973279 missense probably damaging 1.00
R5107:Mettl8 UTSW 2 70965557 missense probably damaging 1.00
R5278:Mettl8 UTSW 2 70973297 missense probably damaging 1.00
R5629:Mettl8 UTSW 2 70965569 missense probably benign
R5864:Mettl8 UTSW 2 70982013 missense probably benign 0.10
R6272:Mettl8 UTSW 2 70976075 splice site probably null
R6402:Mettl8 UTSW 2 70966461 nonsense probably null
R7181:Mettl8 UTSW 2 70973362 missense possibly damaging 0.79
R7288:Mettl8 UTSW 2 70982038 missense probably benign 0.01
R7409:Mettl8 UTSW 2 70973343 missense probably damaging 1.00
R7498:Mettl8 UTSW 2 70965625 missense probably damaging 0.98
R7639:Mettl8 UTSW 2 70982182 missense probably benign
R7789:Mettl8 UTSW 2 70966462 missense probably damaging 1.00
R7795:Mettl8 UTSW 2 70981899 missense probably benign
X0062:Mettl8 UTSW 2 70981974 missense probably benign 0.33
Z1177:Mettl8 UTSW 2 70973338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAAACGTTAGCTTTGCCC -3'
(R):5'- TCACTGACCAGCACCTTTAC -3'

Sequencing Primer
(F):5'- GAAACGTTAGCTTTGCCCTTTCG -3'
(R):5'- TTTACTAACCAAGTCATCTCACTGAC -3'
Posted On2018-06-06