Incidental Mutation 'R6547:Kbtbd11'
ID543431
Institutional Source Beutler Lab
Gene Symbol Kbtbd11
Ensembl Gene ENSMUSG00000055675
Gene Namekelch repeat and BTB (POZ) domain containing 11
Synonyms4930465M17Rik, 2900016B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6547 (G1)
Quality Score74.0075
Status Validated
Chromosome8
Chromosomal Location15011025-15033333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15027641 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 80 (V80E)
Ref Sequence ENSEMBL: ENSMUSP00000139292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069399] [ENSMUST00000183471]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069399
AA Change: V80E

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068321
Gene: ENSMUSG00000055675
AA Change: V80E

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183471
AA Change: V80E

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139292
Gene: ENSMUSG00000055675
AA Change: V80E

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,659,907 probably benign Het
9230113P08Rik T A 9: 35,908,485 M15K probably null Het
Abca13 T A 11: 9,274,757 V490E probably benign Het
Abca2 G T 2: 25,433,338 G106V possibly damaging Het
Ablim3 T C 18: 61,823,929 T276A probably benign Het
Anxa7 A G 14: 20,469,393 V119A probably benign Het
Arl9 A G 5: 77,010,410 probably null Het
Atm T C 9: 53,440,157 Y2964C probably damaging Het
Bbs9 T C 9: 22,514,069 Y140H probably benign Het
Calcr A T 6: 3,717,177 D94E probably damaging Het
Celsr3 T A 9: 108,829,128 Y937N probably damaging Het
Clca3a1 C T 3: 144,736,947 A779T probably damaging Het
Clec9a T A 6: 129,416,376 V94D probably benign Het
Colec12 G T 18: 9,840,351 L57F probably damaging Het
Fa2h T C 8: 111,348,020 Y317C probably damaging Het
Fam126a T C 5: 23,965,100 N417S probably benign Het
Flnc A G 6: 29,448,608 T1282A probably damaging Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Hcn2 G T 10: 79,717,152 V162L probably benign Het
Lama4 A G 10: 39,073,656 D915G probably damaging Het
Limch1 A T 5: 67,028,774 E806V probably damaging Het
Mppe1 T C 18: 67,228,988 I169V probably benign Het
Msc A C 1: 14,755,745 S2A possibly damaging Het
Nploc4 A G 11: 120,428,522 probably null Het
Nr3c2 A T 8: 76,908,809 I180F possibly damaging Het
Nrap G T 19: 56,351,566 H840N probably benign Het
Olfr151 T A 9: 37,730,495 M163L probably benign Het
Pdlim1 G A 19: 40,223,120 T243I probably damaging Het
Pfkl T A 10: 77,995,354 M318L probably benign Het
Rap1gds1 C A 3: 138,955,338 R426L probably damaging Het
Ric1 A G 19: 29,594,826 N674D probably damaging Het
Rp1 G A 1: 4,170,305 T875I unknown Het
Rtn1 G T 12: 72,308,761 S137Y possibly damaging Het
Scn2a A G 2: 65,715,897 I935V probably benign Het
Serpina1a C T 12: 103,855,921 V251M probably damaging Het
Slc19a3 A G 1: 83,022,900 V132A probably damaging Het
Slc26a6 T A 9: 108,860,782 probably null Het
Slc2a5 T A 4: 150,135,619 V164D possibly damaging Het
Slc4a1 T A 11: 102,356,735 T441S probably damaging Het
Stk33 T C 7: 109,320,835 I366V possibly damaging Het
Syt14 G T 1: 192,901,869 H696N possibly damaging Het
Tcaim T A 9: 122,814,466 V77D probably benign Het
Tefm T G 11: 80,140,384 probably null Het
Tekt3 T A 11: 63,070,478 S158T possibly damaging Het
Tmem2 A T 19: 21,844,831 T1197S probably benign Het
Tspan11 T A 6: 127,949,803 M238K possibly damaging Het
Unc5c A T 3: 141,790,019 T476S probably benign Het
Usp9y A T Y: 1,444,612 L109Q probably damaging Homo
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Vps13c C A 9: 67,973,365 Q3495K probably damaging Het
Zbtb10 G A 3: 9,251,703 A192T probably benign Het
Zfp316 A T 5: 143,254,197 V689D probably damaging Het
Zswim1 A G 2: 164,824,796 probably benign Het
Zswim5 T C 4: 116,986,903 L1046P probably damaging Het
Other mutations in Kbtbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Kbtbd11 APN 8 15029176 missense probably damaging 1.00
IGL02160:Kbtbd11 APN 8 15028801 missense probably damaging 1.00
IGL02538:Kbtbd11 APN 8 15028841 missense probably damaging 1.00
IGL03039:Kbtbd11 APN 8 15027467 missense probably benign 0.00
R0152:Kbtbd11 UTSW 8 15027428 missense probably damaging 0.96
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0453:Kbtbd11 UTSW 8 15027499 missense probably benign 0.01
R0498:Kbtbd11 UTSW 8 15027605 missense probably benign
R0629:Kbtbd11 UTSW 8 15027572 missense probably benign
R2031:Kbtbd11 UTSW 8 15028021 missense possibly damaging 0.87
R2214:Kbtbd11 UTSW 8 15029178 missense possibly damaging 0.85
R3720:Kbtbd11 UTSW 8 15029118 nonsense probably null
R3722:Kbtbd11 UTSW 8 15029118 nonsense probably null
R4355:Kbtbd11 UTSW 8 15028578 missense probably damaging 1.00
R4658:Kbtbd11 UTSW 8 15028917 missense possibly damaging 0.59
R5037:Kbtbd11 UTSW 8 15027886 missense probably benign 0.25
R5312:Kbtbd11 UTSW 8 15028589 missense possibly damaging 0.92
R5936:Kbtbd11 UTSW 8 15027534 missense probably benign 0.00
R6056:Kbtbd11 UTSW 8 15027577 missense probably benign
R6272:Kbtbd11 UTSW 8 15029118 nonsense probably null
R7126:Kbtbd11 UTSW 8 15028759 missense probably damaging 1.00
R7359:Kbtbd11 UTSW 8 15028858 missense probably damaging 1.00
Z1088:Kbtbd11 UTSW 8 15027839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCATGGAGAACTCGGTG -3'
(R):5'- AGCACCTCGTAGCAGTTGTC -3'

Sequencing Primer
(F):5'- ACTGAGCCTAGGACTCCTG -3'
(R):5'- TAGCAGTTGTCCAGGCTCAG -3'
Posted On2018-12-11